Mutagenetix > Incidental Mutations

Incidental Mutation 'R2299:Cyfip2'

245273

Institutional Source

Beutler Lab

Gene Symbol

Cyfip2

Ensembl Gene

ENSMUSG00000020340

Gene Name

cytoplasmic FMR1 interacting protein 2

Synonyms

1500004I01Rik, Pir121, 6430511D02Rik

MMRRC Submission

040298-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2299 (G1)

Quality Score

179

Status

Validated

Chromosome

Chromosomal Location

46193850-46312859 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 46286131 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 74 (E74V)

Ref Sequence

ENSEMBL: ENSMUSP00000127586 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093165] [ENSMUST00000093166] [ENSMUST00000165599]

Predicted Effect

probably benign
Transcript: ENSMUST00000093165
AA Change: E74V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000090853
Gene: ENSMUSG00000020340
AA Change: E74V

Domain	Start	End	E-Value	Type
low complexity region	15	27	N/A	INTRINSIC
Pfam:DUF1394	59	303	5.4e-12	PFAM
Pfam:FragX_IP	388	1221	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000093166
AA Change: E74V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000090854
Gene: ENSMUSG00000020340
AA Change: E74V

Domain	Start	End	E-Value	Type
low complexity region	15	27	N/A	INTRINSIC
Pfam:FragX_IP	384	1223	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165599
AA Change: E74V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000127586
Gene: ENSMUSG00000020340
AA Change: E74V

Domain	Start	End	E-Value	Type
low complexity region	15	27	N/A	INTRINSIC
Pfam:FragX_IP	384	1223	N/A	PFAM

Meta Mutation Damage Score

0.1887

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (37/37)

MGI Phenotype

PHENOTYPE: Mice homozygous for knock-out allele exhibit complete neonatal lethality. Mice homozygous for a dominant spontaneous mutation exhibit impaired behavioral response to cocaine, fewer dendritic spines and reduced miniature excitatory postsynaptic current frequency. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930415L06Rik	A	G	X: 89,932,399	M64T	possibly damaging	Het
4933434E20Rik	A	G	3: 90,064,538	N68S	possibly damaging	Het
5031439G07Rik	A	C	15: 84,953,285	F276V	possibly damaging	Het
Abca12	C	T	1: 71,258,222	V2370I	probably damaging	Het
Acsl3	T	G	1: 78,699,110	C469W	probably damaging	Het
Adgrg5	A	T	8: 94,938,576	I372F	possibly damaging	Het
Ankrd42	A	G	7: 92,590,254	I442T	probably benign	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Bmpr1b	C	A	3: 141,845,202	R376L	probably damaging	Het
C1qtnf6	T	A	15: 78,525,342	T102S	probably benign	Het
Chordc1	T	C	9: 18,302,108	L85P	probably damaging	Het
Clec2j	T	A	6: 128,655,236		noncoding transcript	Het
Copa	T	C	1: 172,121,725	I1223T	probably benign	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Dsg1a	A	T	18: 20,340,150	D760V	probably damaging	Het
Folr1	A	G	7: 101,863,992	L32P	probably damaging	Het
Galnt13	A	T	2: 55,060,583	R425S	possibly damaging	Het
Gm4559	A	T	7: 142,273,835	C177S	unknown	Het
H3f3a	C	T	1: 180,803,138	R117H	probably benign	Het
Hist1h2bh	A	G	13: 23,543,184	S57P	probably damaging	Het
Kansl1l	T	C	1: 66,773,477	D459G	probably damaging	Het
Limd1	A	T	9: 123,516,877	K574*	probably null	Het
Mmrn1	A	G	6: 60,976,441	K569E	probably damaging	Het
Olfr583	T	C	7: 103,051,582	W95R	probably damaging	Het
Ppwd1	T	C	13: 104,220,063	M315V	probably benign	Het
Prss21	A	G	17: 23,869,589	E176G	probably benign	Het
Ptpn23	A	G	9: 110,392,513	I173T	possibly damaging	Het
Rit1	T	A	3: 88,726,070		probably null	Het
Rnf14	C	T	18: 38,308,085	A176V	probably benign	Het
Sema5a	T	A	15: 32,562,776	V311E	possibly damaging	Het
Slc28a2	C	T	2: 122,441,778	Q34*	probably null	Het
Spire1	A	C	18: 67,530,423	L36R	probably damaging	Het
Usp33	T	A	3: 152,374,621	V463E	probably damaging	Het
Vcpip1	A	G	1: 9,745,719	L813S	possibly damaging	Het
Vmn1r174	A	T	7: 23,754,004	I32F	probably benign	Het
Zbtb24	G	A	10: 41,464,581	V536M	probably damaging	Het

Other mutations in Cyfip2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00906:Cyfip2	APN	11	46200685	missense	possibly damaging	0.74
IGL01352:Cyfip2	APN	11	46265996	missense	probably benign	0.01
IGL01685:Cyfip2	APN	11	46207488	splice site	probably benign
IGL02367:Cyfip2	APN	11	46276905	nonsense	probably null
IGL02390:Cyfip2	APN	11	46221398	missense	possibly damaging	0.58
IGL02471:Cyfip2	APN	11	46200803	missense	possibly damaging	0.58
IGL02583:Cyfip2	APN	11	46249758	missense	possibly damaging	0.56
IGL03199:Cyfip2	APN	11	46276843	missense	probably benign	0.07
IGL02835:Cyfip2	UTSW	11	46249771	missense	probably benign	0.00
R0081:Cyfip2	UTSW	11	46253998	nonsense	probably null
R0288:Cyfip2	UTSW	11	46253972	missense	possibly damaging	0.94
R1830:Cyfip2	UTSW	11	46199019	missense	probably damaging	1.00
R1869:Cyfip2	UTSW	11	46224168	missense	probably benign	0.40
R1989:Cyfip2	UTSW	11	46253998	nonsense	probably null
R2045:Cyfip2	UTSW	11	46249789	missense	probably benign	0.00
R2101:Cyfip2	UTSW	11	46242443	missense	probably damaging	1.00
R2131:Cyfip2	UTSW	11	46286131	missense	possibly damaging	0.78
R2162:Cyfip2	UTSW	11	46261506	missense	probably benign	0.03
R3831:Cyfip2	UTSW	11	46261506	missense	probably benign	0.03
R3832:Cyfip2	UTSW	11	46261506	missense	probably benign	0.03
R3833:Cyfip2	UTSW	11	46261506	missense	probably benign	0.03
R3881:Cyfip2	UTSW	11	46208335	missense	probably damaging	1.00
R4127:Cyfip2	UTSW	11	46270647	missense	probably benign	0.00
R4385:Cyfip2	UTSW	11	46242403	missense	probably benign	0.05
R4617:Cyfip2	UTSW	11	46254018	missense	probably damaging	1.00
R4739:Cyfip2	UTSW	11	46279993	missense	probably damaging	0.99
R5232:Cyfip2	UTSW	11	46242378	missense	probably damaging	1.00
R5365:Cyfip2	UTSW	11	46247630	missense	probably damaging	0.99
R5383:Cyfip2	UTSW	11	46278091	missense	possibly damaging	0.83
R5447:Cyfip2	UTSW	11	46291586	missense	possibly damaging	0.72
R5450:Cyfip2	UTSW	11	46284252	missense	probably benign	0.00
R5796:Cyfip2	UTSW	11	46198996	missense	probably benign	0.01
R5820:Cyfip2	UTSW	11	46200704	missense	probably damaging	1.00
R5925:Cyfip2	UTSW	11	46207436	missense	probably damaging	1.00
R6143:Cyfip2	UTSW	11	46253965	nonsense	probably null
R6321:Cyfip2	UTSW	11	46291520	missense	probably benign	0.01
R6502:Cyfip2	UTSW	11	46221346	missense	probably damaging	1.00
R6511:Cyfip2	UTSW	11	46196308	missense	probably benign	0.00
R6521:Cyfip2	UTSW	11	46254588	missense	probably damaging	1.00
R6660:Cyfip2	UTSW	11	46249807	missense	possibly damaging	0.89
R6836:Cyfip2	UTSW	11	46272640	missense	probably benign	0.16
R6866:Cyfip2	UTSW	11	46242459	nonsense	probably null
R7062:Cyfip2	UTSW	11	46260832	missense	probably damaging	1.00
R7192:Cyfip2	UTSW	11	46254666	missense	probably benign	0.21
R7231:Cyfip2	UTSW	11	46224136	missense	probably benign
R7258:Cyfip2	UTSW	11	46224177	missense	probably benign	0.02
R7365:Cyfip2	UTSW	11	46207440	nonsense	probably null
R7441:Cyfip2	UTSW	11	46196427	missense	possibly damaging	0.80
R7561:Cyfip2	UTSW	11	46270598	missense	probably benign	0.00
R7831:Cyfip2	UTSW	11	46196446	missense	probably damaging	1.00
R7871:Cyfip2	UTSW	11	46242350	missense	probably damaging	1.00
Z1176:Cyfip2	UTSW	11	46222615	missense	not run
Z1177:Cyfip2	UTSW	11	46222615	missense	not run

Predicted Primers

PCR Primer
(F):5'- GTCAGAGGCCCAGATTTGCTTC -3'
(R):5'- CTTTGGAGTATGCTTTCCATAACTG -3'

Sequencing Primer
(F):5'- AGATTTGCTTCCCGCCAC -3'
(R):5'- ATAAGGTGCCCGTGACTTAC -3'

Posted On

2014-10-30