Mutagenetix > Incidental Mutations

Incidental Mutation 'R2299:Sema5a'

245277

Institutional Source

Beutler Lab

Gene Symbol

Sema5a

Ensembl Gene

ENSMUSG00000022231

Gene Name

sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A

Synonyms

semF, 9130201M22Rik, Semaf, M-Sema D

MMRRC Submission

040298-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2299 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32244810-32696341 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 32562776 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 311 (V311E)

Ref Sequence

ENSEMBL: ENSMUSP00000069024 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067458]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000067458
AA Change: V311E

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000069024
Gene: ENSMUSG00000022231
AA Change: V311E

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Sema	58	468	2.18e-173	SMART
PSI	486	533	1.78e-9	SMART
TSP1	543	597	2.23e-1	SMART
TSP1	598	651	2.05e-15	SMART
TSP1	656	702	6.94e-13	SMART
low complexity region	707	715	N/A	INTRINSIC
low complexity region	755	771	N/A	INTRINSIC
TSP1	787	839	4.17e-16	SMART
TSP1	844	896	9.08e-17	SMART
TSP1	899	946	3.19e-3	SMART
low complexity region	949	960	N/A	INTRINSIC
transmembrane domain	971	993	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226876

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227802

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227976

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228015

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228442

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228555

Meta Mutation Damage Score

0.0815

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been implicated as an autism susceptibility gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for one null mutation die during organogenesis and display defects in branching of cranial vessels. Mice homozygous for another null mutation appear normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930415L06Rik	A	G	X: 89,932,399	M64T	possibly damaging	Het
4933434E20Rik	A	G	3: 90,064,538	N68S	possibly damaging	Het
5031439G07Rik	A	C	15: 84,953,285	F276V	possibly damaging	Het
Abca12	C	T	1: 71,258,222	V2370I	probably damaging	Het
Acsl3	T	G	1: 78,699,110	C469W	probably damaging	Het
Adgrg5	A	T	8: 94,938,576	I372F	possibly damaging	Het
Ankrd42	A	G	7: 92,590,254	I442T	probably benign	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Bmpr1b	C	A	3: 141,845,202	R376L	probably damaging	Het
C1qtnf6	T	A	15: 78,525,342	T102S	probably benign	Het
Chordc1	T	C	9: 18,302,108	L85P	probably damaging	Het
Clec2j	T	A	6: 128,655,236		noncoding transcript	Het
Copa	T	C	1: 172,121,725	I1223T	probably benign	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Cyfip2	T	A	11: 46,286,131	E74V	probably benign	Het
Dsg1a	A	T	18: 20,340,150	D760V	probably damaging	Het
Folr1	A	G	7: 101,863,992	L32P	probably damaging	Het
Galnt13	A	T	2: 55,060,583	R425S	possibly damaging	Het
Gm4559	A	T	7: 142,273,835	C177S	unknown	Het
H3f3a	C	T	1: 180,803,138	R117H	probably benign	Het
Hist1h2bh	A	G	13: 23,543,184	S57P	probably damaging	Het
Kansl1l	T	C	1: 66,773,477	D459G	probably damaging	Het
Limd1	A	T	9: 123,516,877	K574*	probably null	Het
Mmrn1	A	G	6: 60,976,441	K569E	probably damaging	Het
Olfr583	T	C	7: 103,051,582	W95R	probably damaging	Het
Ppwd1	T	C	13: 104,220,063	M315V	probably benign	Het
Prss21	A	G	17: 23,869,589	E176G	probably benign	Het
Ptpn23	A	G	9: 110,392,513	I173T	possibly damaging	Het
Rit1	T	A	3: 88,726,070		probably null	Het
Rnf14	C	T	18: 38,308,085	A176V	probably benign	Het
Slc28a2	C	T	2: 122,441,778	Q34*	probably null	Het
Spire1	A	C	18: 67,530,423	L36R	probably damaging	Het
Usp33	T	A	3: 152,374,621	V463E	probably damaging	Het
Vcpip1	A	G	1: 9,745,719	L813S	possibly damaging	Het
Vmn1r174	A	T	7: 23,754,004	I32F	probably benign	Het
Zbtb24	G	A	10: 41,464,581	V536M	probably damaging	Het

Other mutations in Sema5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00672:Sema5a	APN	15	32618880	missense	probably benign	0.06
IGL01148:Sema5a	APN	15	32681495	missense	probably benign	0.00
IGL01285:Sema5a	APN	15	32574997	missense	possibly damaging	0.66
IGL01647:Sema5a	APN	15	32417441	missense	possibly damaging	0.82
IGL01845:Sema5a	APN	15	32474368	splice site	probably benign
IGL01970:Sema5a	APN	15	32686646	missense	probably benign	0.02
IGL01986:Sema5a	APN	15	32682360	splice site	probably benign
IGL02053:Sema5a	APN	15	32550267	missense	probably benign	0.00
IGL02234:Sema5a	APN	15	32679172	missense	probably damaging	1.00
IGL02325:Sema5a	APN	15	32686831	missense	possibly damaging	0.63
IGL02370:Sema5a	APN	15	32682299	splice site	probably benign
IGL02427:Sema5a	APN	15	32673544	splice site	probably benign
IGL02621:Sema5a	APN	15	32538656	splice site	probably benign
IGL02656:Sema5a	APN	15	32631285	missense	possibly damaging	0.95
IGL03091:Sema5a	APN	15	32538734	splice site	probably benign
IGL03107:Sema5a	APN	15	32669408	missense	probably damaging	0.98
IGL03114:Sema5a	APN	15	32673427	missense	probably damaging	0.99
IGL03222:Sema5a	APN	15	32628158	missense	probably benign	0.32
PIT4305001:Sema5a	UTSW	15	32628199	missense	probably benign
R0190:Sema5a	UTSW	15	32562774	missense	possibly damaging	0.93
R0409:Sema5a	UTSW	15	32681609	missense	probably damaging	1.00
R0413:Sema5a	UTSW	15	32669444	missense	probably damaging	1.00
R0504:Sema5a	UTSW	15	32574803	splice site	probably benign
R1235:Sema5a	UTSW	15	32609226	missense	probably benign	0.04
R1484:Sema5a	UTSW	15	32460285	missense	probably damaging	1.00
R1550:Sema5a	UTSW	15	32618849	missense	probably benign	0.00
R1557:Sema5a	UTSW	15	32460272	missense	probably benign	0.04
R1670:Sema5a	UTSW	15	32548799	missense	probably damaging	1.00
R1688:Sema5a	UTSW	15	32669424	missense	probably benign	0.01
R1760:Sema5a	UTSW	15	32641106	missense	probably damaging	0.99
R1960:Sema5a	UTSW	15	32562731	missense	possibly damaging	0.66
R1967:Sema5a	UTSW	15	32681619	missense	probably damaging	0.99
R2062:Sema5a	UTSW	15	32609217	splice site	probably benign
R2082:Sema5a	UTSW	15	32618856	missense	probably benign	0.04
R2218:Sema5a	UTSW	15	32631309	missense	probably damaging	0.99
R2267:Sema5a	UTSW	15	32574919	missense	probably benign	0.03
R2438:Sema5a	UTSW	15	32550253	missense	possibly damaging	0.63
R2698:Sema5a	UTSW	15	32673400	missense	probably damaging	1.00
R3950:Sema5a	UTSW	15	32689338	missense	probably damaging	1.00
R4197:Sema5a	UTSW	15	32618918	missense	probably benign
R4496:Sema5a	UTSW	15	32640987	missense	probably damaging	1.00
R4840:Sema5a	UTSW	15	32550254	missense	possibly damaging	0.63
R4842:Sema5a	UTSW	15	32609417	missense	probably benign
R4867:Sema5a	UTSW	15	32550290	missense	possibly damaging	0.60
R4934:Sema5a	UTSW	15	32679164	missense	probably damaging	1.00
R4977:Sema5a	UTSW	15	32679186	missense	probably damaging	1.00
R5204:Sema5a	UTSW	15	32686647	missense	probably benign	0.00
R5580:Sema5a	UTSW	15	32574885	missense	probably benign	0.00
R5937:Sema5a	UTSW	15	32574841	missense	probably damaging	1.00
R6220:Sema5a	UTSW	15	32686729	missense	probably damaging	0.99
R6897:Sema5a	UTSW	15	32550275	missense	probably benign	0.05
R7037:Sema5a	UTSW	15	32686847	missense	probably damaging	1.00
R7072:Sema5a	UTSW	15	32574959	missense	possibly damaging	0.94
R7273:Sema5a	UTSW	15	32417462	missense	probably benign
R7572:Sema5a	UTSW	15	32673428	missense	probably damaging	1.00
R7621:Sema5a	UTSW	15	32609232	missense	possibly damaging	0.65
R7642:Sema5a	UTSW	15	32682325	missense	probably damaging	0.97
R7870:Sema5a	UTSW	15	32609339	missense	probably benign	0.23
R7880:Sema5a	UTSW	15	32686808	missense	probably damaging	1.00
R8025:Sema5a	UTSW	15	32548782	missense	probably benign	0.37
R8034:Sema5a	UTSW	15	32574841	missense	probably damaging	1.00
R8241:Sema5a	UTSW	15	32574918	missense	probably benign
R8539:Sema5a	UTSW	15	32618843	missense	probably damaging	0.98
X0020:Sema5a	UTSW	15	32417500	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCTTCCGAGAAAACGCCGTG -3'
(R):5'- AAAGCGAGTCCTGCAAAGC -3'

Sequencing Primer
(F):5'- CTGCCCGGGTCTGTAAAAATGAC -3'
(R):5'- GCGAGTCCTGCAAAGCATATATC -3'

Posted On

2014-10-30