Mutagenetix > Incidental Mutations

Incidental Mutation 'R2299:C1qtnf6'

245278

Institutional Source

Beutler Lab

Gene Symbol

C1qtnf6

Ensembl Gene

ENSMUSG00000022440

Gene Name

C1q and tumor necrosis factor related protein 6

Synonyms

CTRP6, 2810036M19Rik

MMRRC Submission

040298-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2299 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

78523346-78531416 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 78525342 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 102 (T102S)

Ref Sequence

ENSEMBL: ENSMUSP00000023075 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023075] [ENSMUST00000229185] [ENSMUST00000230943]

Predicted Effect

probably benign
Transcript: ENSMUST00000023075
AA Change: T102S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000023075
Gene: ENSMUSG00000022440
AA Change: T102S

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
low complexity region	82	104	N/A	INTRINSIC
C1Q	123	262	1.01e-11	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137827

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147093

Predicted Effect

probably benign
Transcript: ENSMUST00000229185

Predicted Effect

probably benign
Transcript: ENSMUST00000230943

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (37/37)

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930415L06Rik	A	G	X: 89,932,399	M64T	possibly damaging	Het
4933434E20Rik	A	G	3: 90,064,538	N68S	possibly damaging	Het
5031439G07Rik	A	C	15: 84,953,285	F276V	possibly damaging	Het
Abca12	C	T	1: 71,258,222	V2370I	probably damaging	Het
Acsl3	T	G	1: 78,699,110	C469W	probably damaging	Het
Adgrg5	A	T	8: 94,938,576	I372F	possibly damaging	Het
Ankrd42	A	G	7: 92,590,254	I442T	probably benign	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Bmpr1b	C	A	3: 141,845,202	R376L	probably damaging	Het
Chordc1	T	C	9: 18,302,108	L85P	probably damaging	Het
Clec2j	T	A	6: 128,655,236		noncoding transcript	Het
Copa	T	C	1: 172,121,725	I1223T	probably benign	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Cyfip2	T	A	11: 46,286,131	E74V	probably benign	Het
Dsg1a	A	T	18: 20,340,150	D760V	probably damaging	Het
Folr1	A	G	7: 101,863,992	L32P	probably damaging	Het
Galnt13	A	T	2: 55,060,583	R425S	possibly damaging	Het
Gm4559	A	T	7: 142,273,835	C177S	unknown	Het
H3f3a	C	T	1: 180,803,138	R117H	probably benign	Het
Hist1h2bh	A	G	13: 23,543,184	S57P	probably damaging	Het
Kansl1l	T	C	1: 66,773,477	D459G	probably damaging	Het
Limd1	A	T	9: 123,516,877	K574*	probably null	Het
Mmrn1	A	G	6: 60,976,441	K569E	probably damaging	Het
Olfr583	T	C	7: 103,051,582	W95R	probably damaging	Het
Ppwd1	T	C	13: 104,220,063	M315V	probably benign	Het
Prss21	A	G	17: 23,869,589	E176G	probably benign	Het
Ptpn23	A	G	9: 110,392,513	I173T	possibly damaging	Het
Rit1	T	A	3: 88,726,070		probably null	Het
Rnf14	C	T	18: 38,308,085	A176V	probably benign	Het
Sema5a	T	A	15: 32,562,776	V311E	possibly damaging	Het
Slc28a2	C	T	2: 122,441,778	Q34*	probably null	Het
Spire1	A	C	18: 67,530,423	L36R	probably damaging	Het
Usp33	T	A	3: 152,374,621	V463E	probably damaging	Het
Vcpip1	A	G	1: 9,745,719	L813S	possibly damaging	Het
Vmn1r174	A	T	7: 23,754,004	I32F	probably benign	Het
Zbtb24	G	A	10: 41,464,581	V536M	probably damaging	Het

Other mutations in C1qtnf6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:C1qtnf6	APN	15	78524894	missense	probably damaging	1.00
IGL01534:C1qtnf6	APN	15	78525216	missense	probably benign	0.44
IGL02072:C1qtnf6	APN	15	78527351	nonsense	probably null
Santa	UTSW	15	78524892	splice site	probably null
R1524:C1qtnf6	UTSW	15	78524892	splice site	probably null
R1720:C1qtnf6	UTSW	15	78527440	missense	probably damaging	0.99
R4271:C1qtnf6	UTSW	15	78525266	missense	probably benign	0.01
R5731:C1qtnf6	UTSW	15	78527314	missense	probably benign	0.00
R6118:C1qtnf6	UTSW	15	78525395	missense	probably damaging	0.99
R7140:C1qtnf6	UTSW	15	78525083	missense	probably benign	0.00
R7218:C1qtnf6	UTSW	15	78527374	missense	probably benign	0.00
R7317:C1qtnf6	UTSW	15	78525006	missense	probably damaging	1.00
R7438:C1qtnf6	UTSW	15	78525374	missense	probably benign
R7461:C1qtnf6	UTSW	15	78527349	missense	probably benign	0.00
R8122:C1qtnf6	UTSW	15	78527246	missense	probably benign	0.05
X0022:C1qtnf6	UTSW	15	78525035	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCGTGTTCACAAAGACCCTG -3'
(R):5'- AGTTTCACTTCTGCAGAATGGG -3'

Sequencing Primer
(F):5'- ACCCTGTCGAACAGCAGTGAG -3'
(R):5'- CAGCATGCAGTTAGGTGCTC -3'

Posted On

2014-10-30