Incidental Mutation 'R2299:Crygs'
ID245280
Institutional Source Beutler Lab
Gene Symbol Crygs
Ensembl Gene ENSMUSG00000033501
Gene Namecrystallin, gamma S
SynonymsOpj
MMRRC Submission 040298-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2299 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location22805203-22811577 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 22805551 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 102 (G102D)
Ref Sequence ENSEMBL: ENSMUSP00000043588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040592]
PDB Structure
NMR structure of murine gamma-S crystallin [SOLUTION NMR]
NMR structure of murine gamma-S crystallin [SOLUTION NMR]
NMR structure of murine gamma-S crystallin from joint refinement with SAXS data [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040592
AA Change: G102D

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043588
Gene: ENSMUSG00000033501
AA Change: G102D

DomainStartEndE-ValueType
XTALbg 7 86 5.98e-40 SMART
XTALbg 95 176 6.26e-43 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Gamma-crystallins are a homogeneous group of highly symmetrical, monomeric proteins typically lacking connecting peptides and terminal extensions. They are differentially regulated after early development. This gene encodes a protein initially considered to be a beta-crystallin but the encoded protein is monomeric and has greater sequence similarity to other gamma-crystallins. This gene encodes the most significant gamma-crystallin in adult eye lens tissue. Whether due to aging or mutations in specific genes, gamma-crystallins have been involved in cataract formation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene can cause cataracts and/or disrupted lens fiber cell morphology and organization. Aging mice homozygous for a knock-out allele do not develop cataracts but show focusing defects associated with inefficient clearance of cellular organelles and altered actin distribution. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
4933434E20Rik A G 3: 90,064,538 N68S possibly damaging Het
5031439G07Rik A C 15: 84,953,285 F276V possibly damaging Het
Abca12 C T 1: 71,258,222 V2370I probably damaging Het
Acsl3 T G 1: 78,699,110 C469W probably damaging Het
Adgrg5 A T 8: 94,938,576 I372F possibly damaging Het
Ankrd42 A G 7: 92,590,254 I442T probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bmpr1b C A 3: 141,845,202 R376L probably damaging Het
C1qtnf6 T A 15: 78,525,342 T102S probably benign Het
Chordc1 T C 9: 18,302,108 L85P probably damaging Het
Clec2j T A 6: 128,655,236 noncoding transcript Het
Copa T C 1: 172,121,725 I1223T probably benign Het
Cyfip2 T A 11: 46,286,131 E74V probably benign Het
Dsg1a A T 18: 20,340,150 D760V probably damaging Het
Folr1 A G 7: 101,863,992 L32P probably damaging Het
Galnt13 A T 2: 55,060,583 R425S possibly damaging Het
Gm4559 A T 7: 142,273,835 C177S unknown Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Hist1h2bh A G 13: 23,543,184 S57P probably damaging Het
Kansl1l T C 1: 66,773,477 D459G probably damaging Het
Limd1 A T 9: 123,516,877 K574* probably null Het
Mmrn1 A G 6: 60,976,441 K569E probably damaging Het
Olfr583 T C 7: 103,051,582 W95R probably damaging Het
Ppwd1 T C 13: 104,220,063 M315V probably benign Het
Prss21 A G 17: 23,869,589 E176G probably benign Het
Ptpn23 A G 9: 110,392,513 I173T possibly damaging Het
Rit1 T A 3: 88,726,070 probably null Het
Rnf14 C T 18: 38,308,085 A176V probably benign Het
Sema5a T A 15: 32,562,776 V311E possibly damaging Het
Slc28a2 C T 2: 122,441,778 Q34* probably null Het
Spire1 A C 18: 67,530,423 L36R probably damaging Het
Usp33 T A 3: 152,374,621 V463E probably damaging Het
Vcpip1 A G 1: 9,745,719 L813S possibly damaging Het
Vmn1r174 A T 7: 23,754,004 I32F probably benign Het
Zbtb24 G A 10: 41,464,581 V536M probably damaging Het
Other mutations in Crygs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Crygs APN 16 22806562 missense possibly damaging 0.81
R1694:Crygs UTSW 16 22806675 splice site probably null
R1932:Crygs UTSW 16 22806554 missense probably benign 0.12
R2206:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2207:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2275:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2298:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2300:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2326:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2329:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2330:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2331:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2332:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2857:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2895:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2896:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2921:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2922:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3120:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3196:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3427:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3609:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3611:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3625:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3693:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3694:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3695:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3870:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3871:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3876:Crygs UTSW 16 22806512 missense probably damaging 1.00
R4052:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R4207:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R4299:Crygs UTSW 16 22805411 nonsense probably null
R4630:Crygs UTSW 16 22805518 missense possibly damaging 0.90
R7392:Crygs UTSW 16 22806502 missense probably benign 0.35
R7573:Crygs UTSW 16 22805319 makesense probably null
R7954:Crygs UTSW 16 22805332 missense probably damaging 1.00
R7955:Crygs UTSW 16 22805332 missense probably damaging 1.00
R7957:Crygs UTSW 16 22805332 missense probably damaging 1.00
R8172:Crygs UTSW 16 22806542 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCTATGGTCCCACTCCAG -3'
(R):5'- CAACCAGAGTTCTGATGACCC -3'

Sequencing Primer
(F):5'- TCACTCCACAATGCGGCG -3'
(R):5'- TGATGACCCTCCCTTAAGGATGAG -3'
Posted On2014-10-30