Incidental Mutation 'R2299:Rnf14'
ID245285
Institutional Source Beutler Lab
Gene Symbol Rnf14
Ensembl Gene ENSMUSG00000060450
Gene Namering finger protein 14
Synonyms2310075C09Rik, Triad2, 2610005D23Rik, D18Ertd188e, D7Bwg0165e
MMRRC Submission 040298-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.707) question?
Stock #R2299 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location38296635-38317847 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 38308085 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 176 (A176V)
Ref Sequence ENSEMBL: ENSMUSP00000126205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072376] [ENSMUST00000170811] [ENSMUST00000171461]
Predicted Effect probably benign
Transcript: ENSMUST00000072376
AA Change: A176V

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000072212
Gene: ENSMUSG00000060450
AA Change: A176V

DomainStartEndE-ValueType
RWD 11 137 2.36e-32 SMART
low complexity region 169 179 N/A INTRINSIC
RING 221 266 6.51e-2 SMART
IBR 290 351 3.15e-18 SMART
IBR 387 454 2.11e-1 SMART
low complexity region 470 485 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170811
AA Change: A50V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000133070
Gene: ENSMUSG00000060450
AA Change: A50V

DomainStartEndE-ValueType
low complexity region 43 53 N/A INTRINSIC
RING 95 140 6.51e-2 SMART
IBR 164 225 3.15e-18 SMART
IBR 261 328 2.11e-1 SMART
low complexity region 344 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171461
AA Change: A176V

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000126205
Gene: ENSMUSG00000060450
AA Change: A176V

DomainStartEndE-ValueType
RWD 11 137 2.36e-32 SMART
low complexity region 169 179 N/A INTRINSIC
RING 221 266 6.51e-2 SMART
IBR 290 351 3.15e-18 SMART
IBR 387 454 2.11e-1 SMART
low complexity region 470 485 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING zinc finger, a motif known to be involved in protein-protein interactions. This protein interacts with androgen receptor (AR) and may function as a coactivator that induces AR target gene expression in prostate. A dominant negative mutant of this gene has been demonstrated to inhibit the AR-mediated growth of prostate cancer. This protein also interacts with class III ubiquitin-conjugating enzymes (E2s) and may act as a ubiquitin-ligase (E3) in the ubiquitination of certain nuclear proteins. Six alternatively spliced transcript variants encoding two distinct isoforms have been reported. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
4933434E20Rik A G 3: 90,064,538 N68S possibly damaging Het
5031439G07Rik A C 15: 84,953,285 F276V possibly damaging Het
Abca12 C T 1: 71,258,222 V2370I probably damaging Het
Acsl3 T G 1: 78,699,110 C469W probably damaging Het
Adgrg5 A T 8: 94,938,576 I372F possibly damaging Het
Ankrd42 A G 7: 92,590,254 I442T probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bmpr1b C A 3: 141,845,202 R376L probably damaging Het
C1qtnf6 T A 15: 78,525,342 T102S probably benign Het
Chordc1 T C 9: 18,302,108 L85P probably damaging Het
Clec2j T A 6: 128,655,236 noncoding transcript Het
Copa T C 1: 172,121,725 I1223T probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyfip2 T A 11: 46,286,131 E74V probably benign Het
Dsg1a A T 18: 20,340,150 D760V probably damaging Het
Folr1 A G 7: 101,863,992 L32P probably damaging Het
Galnt13 A T 2: 55,060,583 R425S possibly damaging Het
Gm4559 A T 7: 142,273,835 C177S unknown Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Hist1h2bh A G 13: 23,543,184 S57P probably damaging Het
Kansl1l T C 1: 66,773,477 D459G probably damaging Het
Limd1 A T 9: 123,516,877 K574* probably null Het
Mmrn1 A G 6: 60,976,441 K569E probably damaging Het
Olfr583 T C 7: 103,051,582 W95R probably damaging Het
Ppwd1 T C 13: 104,220,063 M315V probably benign Het
Prss21 A G 17: 23,869,589 E176G probably benign Het
Ptpn23 A G 9: 110,392,513 I173T possibly damaging Het
Rit1 T A 3: 88,726,070 probably null Het
Sema5a T A 15: 32,562,776 V311E possibly damaging Het
Slc28a2 C T 2: 122,441,778 Q34* probably null Het
Spire1 A C 18: 67,530,423 L36R probably damaging Het
Usp33 T A 3: 152,374,621 V463E probably damaging Het
Vcpip1 A G 1: 9,745,719 L813S possibly damaging Het
Vmn1r174 A T 7: 23,754,004 I32F probably benign Het
Zbtb24 G A 10: 41,464,581 V536M probably damaging Het
Other mutations in Rnf14
AlleleSourceChrCoordTypePredicted EffectPPH Score
Aloft UTSW 18 38308382 missense probably damaging 1.00
souffle UTSW 18 38309576 missense probably damaging 1.00
R1682:Rnf14 UTSW 18 38308189 missense probably benign 0.00
R4246:Rnf14 UTSW 18 38301648 splice site probably null
R4941:Rnf14 UTSW 18 38308382 missense probably damaging 1.00
R5056:Rnf14 UTSW 18 38308388 missense probably damaging 1.00
R6082:Rnf14 UTSW 18 38301670 missense possibly damaging 0.69
R7070:Rnf14 UTSW 18 38301728 missense possibly damaging 0.66
R7772:Rnf14 UTSW 18 38309576 missense probably damaging 1.00
RF014:Rnf14 UTSW 18 38309570 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCTGTGGGAAGAACACCG -3'
(R):5'- TGCAGTATACATGCTTGCACTCC -3'

Sequencing Primer
(F):5'- CACCGAGGCAGAGTGGTG -3'
(R):5'- TTGCACTCCAAGAAGTACATGC -3'
Posted On2014-10-30