Incidental Mutation 'R2299:4930415L06Rik'
ID245288
Institutional Source Beutler Lab
Gene Symbol 4930415L06Rik
Ensembl Gene ENSMUSG00000035387
Gene NameRIKEN cDNA 4930415L06 gene
Synonyms
MMRRC Submission 040298-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R2299 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location89930098-89932852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89932399 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 64 (M64T)
Ref Sequence ENSEMBL: ENSMUSP00000085471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088146]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088146
AA Change: M64T

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000085471
Gene: ENSMUSG00000035387
AA Change: M64T

DomainStartEndE-ValueType
SCOP:d1k5db_ 18 107 1e-22 SMART
Pfam:SMK-1 178 369 9e-72 PFAM
low complexity region 650 663 N/A INTRINSIC
low complexity region 692 707 N/A INTRINSIC
low complexity region 774 791 N/A INTRINSIC
low complexity region 793 806 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik A G 3: 90,064,538 N68S possibly damaging Het
5031439G07Rik A C 15: 84,953,285 F276V possibly damaging Het
Abca12 C T 1: 71,258,222 V2370I probably damaging Het
Acsl3 T G 1: 78,699,110 C469W probably damaging Het
Adgrg5 A T 8: 94,938,576 I372F possibly damaging Het
Ankrd42 A G 7: 92,590,254 I442T probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bmpr1b C A 3: 141,845,202 R376L probably damaging Het
C1qtnf6 T A 15: 78,525,342 T102S probably benign Het
Chordc1 T C 9: 18,302,108 L85P probably damaging Het
Clec2j T A 6: 128,655,236 noncoding transcript Het
Copa T C 1: 172,121,725 I1223T probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyfip2 T A 11: 46,286,131 E74V probably benign Het
Dsg1a A T 18: 20,340,150 D760V probably damaging Het
Folr1 A G 7: 101,863,992 L32P probably damaging Het
Galnt13 A T 2: 55,060,583 R425S possibly damaging Het
Gm4559 A T 7: 142,273,835 C177S unknown Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Hist1h2bh A G 13: 23,543,184 S57P probably damaging Het
Kansl1l T C 1: 66,773,477 D459G probably damaging Het
Limd1 A T 9: 123,516,877 K574* probably null Het
Mmrn1 A G 6: 60,976,441 K569E probably damaging Het
Olfr583 T C 7: 103,051,582 W95R probably damaging Het
Ppwd1 T C 13: 104,220,063 M315V probably benign Het
Prss21 A G 17: 23,869,589 E176G probably benign Het
Ptpn23 A G 9: 110,392,513 I173T possibly damaging Het
Rit1 T A 3: 88,726,070 probably null Het
Rnf14 C T 18: 38,308,085 A176V probably benign Het
Sema5a T A 15: 32,562,776 V311E possibly damaging Het
Slc28a2 C T 2: 122,441,778 Q34* probably null Het
Spire1 A C 18: 67,530,423 L36R probably damaging Het
Usp33 T A 3: 152,374,621 V463E probably damaging Het
Vcpip1 A G 1: 9,745,719 L813S possibly damaging Het
Vmn1r174 A T 7: 23,754,004 I32F probably benign Het
Zbtb24 G A 10: 41,464,581 V536M probably damaging Het
Other mutations in 4930415L06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02024:4930415L06Rik APN X 89931523 missense probably benign 0.17
IGL02226:4930415L06Rik APN X 89931912 missense probably damaging 0.99
R1980:4930415L06Rik UTSW X 89931445 missense probably damaging 1.00
R1981:4930415L06Rik UTSW X 89931445 missense probably damaging 1.00
R1982:4930415L06Rik UTSW X 89931445 missense probably damaging 1.00
R2381:4930415L06Rik UTSW X 89930510 missense probably benign 0.34
R2895:4930415L06Rik UTSW X 89932399 missense possibly damaging 0.72
R2896:4930415L06Rik UTSW X 89932399 missense possibly damaging 0.72
R4001:4930415L06Rik UTSW X 89930510 missense probably benign 0.34
R4003:4930415L06Rik UTSW X 89930510 missense probably benign 0.34
R4042:4930415L06Rik UTSW X 89932303 missense probably damaging 1.00
R4043:4930415L06Rik UTSW X 89932303 missense probably damaging 1.00
R4280:4930415L06Rik UTSW X 89932499 missense probably damaging 1.00
R4281:4930415L06Rik UTSW X 89932499 missense probably damaging 1.00
R4282:4930415L06Rik UTSW X 89932499 missense probably damaging 1.00
Z1088:4930415L06Rik UTSW X 89930236 missense unknown
Z1088:4930415L06Rik UTSW X 89930237 missense unknown
Z1176:4930415L06Rik UTSW X 89930241 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCAGATCATCAGTAAGTTCTTGTG -3'
(R):5'- AGGTCTGCAAAATGACGTGG -3'

Sequencing Primer
(F):5'- GTGATTTCTACATGTGGGTCTTTACC -3'
(R):5'- TCTGCAAAATGACGTGGCCTAG -3'
Posted On2014-10-30