Incidental Mutation 'R2300:St18'
ID 245289
Institutional Source Beutler Lab
Gene Symbol St18
Ensembl Gene ENSMUSG00000033740
Gene Name suppression of tumorigenicity 18
Synonyms Nzf3, Myt3
MMRRC Submission 040299-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2300 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 6487231-6860940 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 6855402 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 928 (D928G)
Ref Sequence ENSEMBL: ENSMUSP00000131417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043578] [ENSMUST00000131494] [ENSMUST00000140079] [ENSMUST00000150761] [ENSMUST00000151281] [ENSMUST00000163727]
AlphaFold Q80TY4
Predicted Effect probably damaging
Transcript: ENSMUST00000043578
AA Change: D928G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042056
Gene: ENSMUSG00000033740
AA Change: D928G

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 365 392 7.8e-15 PFAM
Pfam:zf-C2HC 409 437 4.2e-17 PFAM
Pfam:MYT1 476 713 1.3e-75 PFAM
Pfam:zf-C2HC 721 749 4e-19 PFAM
Pfam:zf-C2HC 765 793 1.7e-19 PFAM
Pfam:zf-C2HC 813 841 1.1e-17 PFAM
Pfam:zf-C2HC 866 893 9.1e-15 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130338
Predicted Effect probably damaging
Transcript: ENSMUST00000131494
AA Change: D928G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117789
Gene: ENSMUSG00000033740
AA Change: D928G

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000140079
AA Change: D928G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118322
Gene: ENSMUSG00000033740
AA Change: D928G

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150761
AA Change: D928G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120298
Gene: ENSMUSG00000033740
AA Change: D928G

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000151281
AA Change: D928G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122055
Gene: ENSMUSG00000033740
AA Change: D928G

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163727
AA Change: D928G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131417
Gene: ENSMUSG00000033740
AA Change: D928G

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 365 392 7.8e-15 PFAM
Pfam:zf-C2HC 409 437 4.2e-17 PFAM
Pfam:MYT1 476 713 1.3e-75 PFAM
Pfam:zf-C2HC 721 749 4e-19 PFAM
Pfam:zf-C2HC 765 793 1.7e-19 PFAM
Pfam:zf-C2HC 813 841 1.1e-17 PFAM
Pfam:zf-C2HC 866 893 9.1e-15 PFAM
coiled coil region 918 987 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 G T 8: 83,930,117 E355* probably null Het
Aldh6a1 G T 12: 84,439,529 T205N probably damaging Het
Arhgap24 A G 5: 102,860,425 I71V probably damaging Het
Arid2 A T 15: 96,402,006 E1800V probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cd53 T C 3: 106,763,256 T154A probably benign Het
Chd7 G A 4: 8,855,241 A2157T probably benign Het
Clca4b A T 3: 144,916,671 N544K probably benign Het
Cntrl A G 2: 35,127,513 E444G probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Gabrr1 A G 4: 33,152,449 K130E probably benign Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Jag1 T C 2: 137,096,315 Y255C probably damaging Het
Kif11 A G 19: 37,411,539 T825A probably benign Het
Lama4 T A 10: 39,087,320 M1296K probably benign Het
Lrp1 G T 10: 127,556,915 C2760* probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Nolc1 CAG CAGAAG 19: 46,081,359 probably benign Het
Nolc1 CAG CAGTAG 19: 46,081,368 probably benign Het
Nop16 A G 13: 54,585,866 probably null Het
Olfr134 T A 17: 38,175,550 Y155* probably null Het
Olfr992 T C 2: 85,400,132 I134V probably benign Het
Ostf1 T C 19: 18,581,280 D213G probably damaging Het
Slc28a2 C T 2: 122,441,778 Q34* probably null Het
Stag1 T C 9: 100,712,500 V31A possibly damaging Het
Tcl1b1 G A 12: 105,164,524 A89T probably benign Het
Tsen54 A T 11: 115,822,078 S464C probably damaging Het
Ttn A G 2: 76,907,448 F4249S probably benign Het
Xdh A G 17: 73,891,265 F1209S probably damaging Het
Ylpm1 G A 12: 85,060,319 probably null Het
Other mutations in St18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:St18 APN 1 6802572 missense probably benign 0.07
IGL00840:St18 APN 1 6833594 missense probably damaging 1.00
IGL01016:St18 APN 1 6844323 missense probably damaging 0.98
IGL01116:St18 APN 1 6802632 missense probably damaging 0.96
IGL01719:St18 APN 1 6845796 splice site probably benign
IGL01885:St18 APN 1 6844372 critical splice donor site probably null
IGL02486:St18 APN 1 6820083 missense probably damaging 1.00
IGL02611:St18 APN 1 6768890 splice site probably benign
IGL02742:St18 APN 1 6802316 splice site probably benign
IGL02953:St18 APN 1 6844113 splice site probably benign
IGL02999:St18 APN 1 6817605 missense probably benign 0.01
IGL03092:St18 APN 1 6768894 splice site probably benign
Smallish UTSW 1 6855473 critical splice donor site probably null
IGL03055:St18 UTSW 1 6802735 missense probably damaging 0.99
R0089:St18 UTSW 1 6848948 missense probably benign 0.02
R0257:St18 UTSW 1 6819962 missense probably benign 0.04
R0383:St18 UTSW 1 6803024 missense probably damaging 1.00
R0588:St18 UTSW 1 6817738 missense probably damaging 0.99
R0989:St18 UTSW 1 6827881 missense probably benign 0.04
R1068:St18 UTSW 1 6795562 missense probably benign 0.01
R1311:St18 UTSW 1 6845644 missense probably damaging 1.00
R1530:St18 UTSW 1 6845569 critical splice acceptor site probably null
R1723:St18 UTSW 1 6810685 splice site probably benign
R1926:St18 UTSW 1 6802689 missense probably benign 0.00
R1927:St18 UTSW 1 6802712 missense probably benign 0.00
R2035:St18 UTSW 1 6802328 missense probably benign 0.00
R2091:St18 UTSW 1 6827971 missense probably benign 0.08
R2139:St18 UTSW 1 6810615 missense possibly damaging 0.85
R2261:St18 UTSW 1 6845572 missense probably damaging 0.96
R2322:St18 UTSW 1 6844124 nonsense probably null
R2846:St18 UTSW 1 6845587 missense probably damaging 0.96
R3738:St18 UTSW 1 6855473 critical splice donor site probably null
R3739:St18 UTSW 1 6855473 critical splice donor site probably null
R3772:St18 UTSW 1 6844329 missense probably damaging 1.00
R3805:St18 UTSW 1 6802353 missense probably damaging 1.00
R3953:St18 UTSW 1 6802893 missense probably damaging 0.99
R4034:St18 UTSW 1 6855473 critical splice donor site probably null
R4036:St18 UTSW 1 6827786 missense probably damaging 1.00
R4407:St18 UTSW 1 6827837 missense probably benign 0.29
R4527:St18 UTSW 1 6855423 missense probably damaging 1.00
R4740:St18 UTSW 1 6817604 missense probably benign
R4838:St18 UTSW 1 6802905 missense probably benign 0.01
R5182:St18 UTSW 1 6817653 missense probably benign 0.03
R5186:St18 UTSW 1 6802317 splice site probably null
R5354:St18 UTSW 1 6844171 missense probably damaging 1.00
R5423:St18 UTSW 1 6802616 missense possibly damaging 0.91
R5724:St18 UTSW 1 6770950 missense probably benign 0.13
R6182:St18 UTSW 1 6844118 splice site probably null
R6491:St18 UTSW 1 6827985 nonsense probably null
R6503:St18 UTSW 1 6795397 missense probably damaging 1.00
R7037:St18 UTSW 1 6803036 missense possibly damaging 0.65
R7098:St18 UTSW 1 6827842 missense probably damaging 1.00
R7132:St18 UTSW 1 6859127 missense
R7144:St18 UTSW 1 6833594 missense probably damaging 1.00
R7150:St18 UTSW 1 6803019 missense probably damaging 1.00
R7334:St18 UTSW 1 6802559 missense probably benign 0.00
R7502:St18 UTSW 1 6827970 missense probably benign 0.09
R7729:St18 UTSW 1 6802537 missense probably benign 0.00
R7848:St18 UTSW 1 6857445 critical splice donor site probably null
R8088:St18 UTSW 1 6828005 missense probably benign 0.00
R8299:St18 UTSW 1 6802992 missense probably benign 0.01
R8338:St18 UTSW 1 6809292 missense probably damaging 1.00
R8690:St18 UTSW 1 6802564 missense probably benign
R8753:St18 UTSW 1 6845791 missense probably damaging 1.00
R8808:St18 UTSW 1 6810602 missense probably damaging 1.00
R8880:St18 UTSW 1 6795395 nonsense probably null
R9055:St18 UTSW 1 6802982 nonsense probably null
R9292:St18 UTSW 1 6827882 missense probably benign 0.32
R9322:St18 UTSW 1 6795523 missense probably benign 0.00
R9530:St18 UTSW 1 6802773 missense probably benign 0.00
R9603:St18 UTSW 1 6845587 missense probably damaging 1.00
R9611:St18 UTSW 1 6802923 missense probably benign 0.00
R9639:St18 UTSW 1 6859022 missense
R9644:St18 UTSW 1 6859052 missense
R9740:St18 UTSW 1 6803063 nonsense probably null
R9750:St18 UTSW 1 6802992 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTATGGAGCACAGTGGACC -3'
(R):5'- CTGACAGAGAAACACATTGCTC -3'

Sequencing Primer
(F):5'- GACCCACCTGAAAGCTGGTTC -3'
(R):5'- CAAGACTCAGGAAGGTCAA -3'
Posted On 2014-10-30