Incidental Mutation 'R2300:Cd53'
ID 245296
Institutional Source Beutler Lab
Gene Symbol Cd53
Ensembl Gene ENSMUSG00000040747
Gene Name CD53 antigen
Synonyms Tspan25, Ox-44
MMRRC Submission 040299-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.206) question?
Stock # R2300 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 106667237-106697465 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 106670572 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 154 (T154A)
Ref Sequence ENSEMBL: ENSMUSP00000035781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038845]
AlphaFold Q61451
Predicted Effect probably benign
Transcript: ENSMUST00000038845
AA Change: T154A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035781
Gene: ENSMUSG00000040747
AA Change: T154A

DomainStartEndE-ValueType
Pfam:Tetraspannin 8 210 4.6e-54 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins. It contributes to the transduction of CD2-generated signals in T cells and natural killer cells and has been suggested to play a role in growth regulation. Familial deficiency of this gene has been linked to an immunodeficiency associated with recurrent infectious diseases caused by bacteria, fungi and viruses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: B cells lacking this gene exhibit impaired PKC recruitment to the plasma membrane and phosphorylation of PKC substrates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 G T 8: 84,656,746 (GRCm39) E355* probably null Het
Aldh6a1 G T 12: 84,486,303 (GRCm39) T205N probably damaging Het
Arhgap24 A G 5: 103,008,291 (GRCm39) I71V probably damaging Het
Arid2 A T 15: 96,299,887 (GRCm39) E1800V probably damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Chd7 G A 4: 8,855,241 (GRCm39) A2157T probably benign Het
Clca4b A T 3: 144,622,432 (GRCm39) N544K probably benign Het
Cntrl A G 2: 35,017,525 (GRCm39) E444G probably benign Het
Crygs C T 16: 22,624,301 (GRCm39) G102D possibly damaging Het
Gabrr1 A G 4: 33,152,449 (GRCm39) K130E probably benign Het
H3f3a C T 1: 180,630,703 (GRCm39) R117H probably benign Het
Jag1 T C 2: 136,938,235 (GRCm39) Y255C probably damaging Het
Kif11 A G 19: 37,399,987 (GRCm39) T825A probably benign Het
Lama4 T A 10: 38,963,316 (GRCm39) M1296K probably benign Het
Lrp1 G T 10: 127,392,784 (GRCm39) C2760* probably null Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Nolc1 CAG CAGAAG 19: 46,069,798 (GRCm39) probably benign Het
Nolc1 CAG CAGTAG 19: 46,069,807 (GRCm39) probably benign Het
Nop16 A G 13: 54,733,679 (GRCm39) probably null Het
Or2n1 T A 17: 38,486,441 (GRCm39) Y155* probably null Het
Or5ak22 T C 2: 85,230,476 (GRCm39) I134V probably benign Het
Ostf1 T C 19: 18,558,644 (GRCm39) D213G probably damaging Het
Slc28a2 C T 2: 122,272,259 (GRCm39) Q34* probably null Het
St18 A G 1: 6,925,626 (GRCm39) D928G probably damaging Het
Stag1 T C 9: 100,594,553 (GRCm39) V31A possibly damaging Het
Tcl1b1 G A 12: 105,130,783 (GRCm39) A89T probably benign Het
Tsen54 A T 11: 115,712,904 (GRCm39) S464C probably damaging Het
Ttn A G 2: 76,737,792 (GRCm39) F4249S probably benign Het
Xdh A G 17: 74,198,260 (GRCm39) F1209S probably damaging Het
Ylpm1 G A 12: 85,107,093 (GRCm39) probably null Het
Other mutations in Cd53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02500:Cd53 APN 3 106,676,142 (GRCm39) missense probably damaging 1.00
IGL02592:Cd53 APN 3 106,670,601 (GRCm39) missense probably damaging 1.00
R0090:Cd53 UTSW 3 106,674,725 (GRCm39) missense possibly damaging 0.94
R0392:Cd53 UTSW 3 106,670,592 (GRCm39) missense probably damaging 1.00
R0538:Cd53 UTSW 3 106,669,444 (GRCm39) missense probably benign 0.07
R1452:Cd53 UTSW 3 106,676,275 (GRCm39) missense probably damaging 1.00
R1693:Cd53 UTSW 3 106,676,205 (GRCm39) missense possibly damaging 0.66
R2042:Cd53 UTSW 3 106,674,740 (GRCm39) critical splice acceptor site probably null
R2878:Cd53 UTSW 3 106,674,732 (GRCm39) missense probably benign 0.00
R4081:Cd53 UTSW 3 106,669,461 (GRCm39) missense probably benign
R6180:Cd53 UTSW 3 106,674,680 (GRCm39) missense probably damaging 0.96
R6519:Cd53 UTSW 3 106,669,461 (GRCm39) missense probably benign 0.00
R6694:Cd53 UTSW 3 106,674,702 (GRCm39) missense probably benign 0.03
R7043:Cd53 UTSW 3 106,670,577 (GRCm39) missense probably damaging 1.00
R7417:Cd53 UTSW 3 106,676,235 (GRCm39) missense probably benign 0.17
R7736:Cd53 UTSW 3 106,675,252 (GRCm39) missense probably benign 0.12
R7893:Cd53 UTSW 3 106,674,702 (GRCm39) missense probably benign 0.03
R9493:Cd53 UTSW 3 106,674,683 (GRCm39) missense probably null 0.66
Predicted Primers PCR Primer
(F):5'- AACTTGCTCCTAGATTTTGGAAGC -3'
(R):5'- GTCTGTAGCAGTAGACCAATTCTG -3'

Sequencing Primer
(F):5'- GAGCGGTTCCCTGCTCATTC -3'
(R):5'- AGCAGTAGACCAATTCTGAATTTTC -3'
Posted On 2014-10-30