Incidental Mutation 'R2300:Tsen54'
ID245307
Institutional Source Beutler Lab
Gene Symbol Tsen54
Ensembl Gene ENSMUSG00000020781
Gene NametRNA splicing endonuclease subunit 54
Synonyms
MMRRC Submission 040299-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R2300 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location115814724-115823094 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115822078 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 464 (S464C)
Ref Sequence ENSEMBL: ENSMUSP00000021134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021134] [ENSMUST00000103032] [ENSMUST00000106481] [ENSMUST00000133250] [ENSMUST00000136343] [ENSMUST00000154304] [ENSMUST00000177736]
Predicted Effect probably damaging
Transcript: ENSMUST00000021134
AA Change: S464C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021134
Gene: ENSMUSG00000020781
AA Change: S464C

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 30 N/A INTRINSIC
Pfam:tRNA_int_end_N2 63 130 1.4e-21 PFAM
low complexity region 196 208 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
low complexity region 314 324 N/A INTRINSIC
coiled coil region 338 360 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103032
SMART Domains Protein: ENSMUSP00000099321
Gene: ENSMUSG00000020782

DomainStartEndE-ValueType
WD40 24 60 9.17e1 SMART
WD40 62 101 7.96e0 SMART
Blast:WD40 112 157 6e-20 BLAST
WD40 181 217 3.96e1 SMART
WD40 221 258 5.7e1 SMART
Pfam:LLGL 268 372 3.2e-47 PFAM
WD40 411 451 1.38e0 SMART
Blast:WD40 489 532 3e-12 BLAST
low complexity region 536 547 N/A INTRINSIC
Blast:WD40 576 615 2e-10 BLAST
low complexity region 649 668 N/A INTRINSIC
Blast:WD40 830 879 2e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106481
SMART Domains Protein: ENSMUSP00000102090
Gene: ENSMUSG00000020781

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 30 N/A INTRINSIC
Pfam:tRNA_int_end_N2 62 132 1.9e-23 PFAM
low complexity region 196 208 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
low complexity region 314 324 N/A INTRINSIC
coiled coil region 338 360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128266
Predicted Effect probably benign
Transcript: ENSMUST00000133250
SMART Domains Protein: ENSMUSP00000118344
Gene: ENSMUSG00000020782

DomainStartEndE-ValueType
Blast:WD40 13 60 2e-20 BLAST
SCOP:d1gxra_ 19 118 5e-8 SMART
Blast:WD40 62 101 4e-22 BLAST
Blast:WD40 112 146 1e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000136343
SMART Domains Protein: ENSMUSP00000120506
Gene: ENSMUSG00000020781

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 158 168 N/A INTRINSIC
coiled coil region 182 204 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141748
Predicted Effect possibly damaging
Transcript: ENSMUST00000154304
AA Change: S147C

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116955
Gene: ENSMUSG00000020781
AA Change: S147C

DomainStartEndE-ValueType
coiled coil region 21 43 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000157061
AA Change: S101C
Predicted Effect probably benign
Transcript: ENSMUST00000177736
SMART Domains Protein: ENSMUSP00000136054
Gene: ENSMUSG00000020782

DomainStartEndE-ValueType
WD40 24 60 5.9e-1 SMART
WD40 62 101 5.2e-2 SMART
Blast:WD40 112 157 6e-20 BLAST
WD40 181 217 2.5e-1 SMART
WD40 221 258 3.6e-1 SMART
Pfam:LLGL 271 372 6.2e-41 PFAM
WD40 411 451 8.8e-3 SMART
Blast:WD40 489 532 3e-12 BLAST
low complexity region 536 547 N/A INTRINSIC
Blast:WD40 576 615 2e-10 BLAST
low complexity region 649 668 N/A INTRINSIC
Blast:WD40 854 903 2e-10 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the tRNA splicing endonuclease complex, which catalyzes the removal of introns from precursor tRNAs. The complex is also implicated in pre-mRNA 3-prime end processing. Mutations in this gene result in pontocerebellar hypoplasia type 2.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 G T 8: 83,930,117 E355* probably null Het
Aldh6a1 G T 12: 84,439,529 T205N probably damaging Het
Arhgap24 A G 5: 102,860,425 I71V probably damaging Het
Arid2 A T 15: 96,402,006 E1800V probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cd53 T C 3: 106,763,256 T154A probably benign Het
Chd7 G A 4: 8,855,241 A2157T probably benign Het
Clca4b A T 3: 144,916,671 N544K probably benign Het
Cntrl A G 2: 35,127,513 E444G probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Gabrr1 A G 4: 33,152,449 K130E probably benign Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Jag1 T C 2: 137,096,315 Y255C probably damaging Het
Kif11 A G 19: 37,411,539 T825A probably benign Het
Lama4 T A 10: 39,087,320 M1296K probably benign Het
Lrp1 G T 10: 127,556,915 C2760* probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Nolc1 CAG CAGAAG 19: 46,081,359 probably benign Het
Nolc1 CAG CAGTAG 19: 46,081,368 probably benign Het
Nop16 A G 13: 54,585,866 probably null Het
Olfr134 T A 17: 38,175,550 Y155* probably null Het
Olfr992 T C 2: 85,400,132 I134V probably benign Het
Ostf1 T C 19: 18,581,280 D213G probably damaging Het
Slc28a2 C T 2: 122,441,778 Q34* probably null Het
St18 A G 1: 6,855,402 D928G probably damaging Het
Stag1 T C 9: 100,712,500 V31A possibly damaging Het
Tcl1b1 G A 12: 105,164,524 A89T probably benign Het
Ttn A G 2: 76,907,448 F4249S probably benign Het
Xdh A G 17: 73,891,265 F1209S probably damaging Het
Ylpm1 G A 12: 85,060,319 probably null Het
Other mutations in Tsen54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Tsen54 APN 11 115821712 missense possibly damaging 0.90
PIT4486001:Tsen54 UTSW 11 115822596 missense probably damaging 1.00
R0179:Tsen54 UTSW 11 115822030 missense probably damaging 1.00
R0255:Tsen54 UTSW 11 115815408 missense probably damaging 1.00
R0380:Tsen54 UTSW 11 115822597 missense probably damaging 1.00
R0619:Tsen54 UTSW 11 115815064 missense probably damaging 1.00
R0653:Tsen54 UTSW 11 115815061 missense probably damaging 1.00
R1120:Tsen54 UTSW 11 115815013 missense probably damaging 0.98
R2109:Tsen54 UTSW 11 115815723 missense probably damaging 1.00
R2248:Tsen54 UTSW 11 115815406 missense probably damaging 1.00
R3081:Tsen54 UTSW 11 115820164 missense probably benign 0.08
R3763:Tsen54 UTSW 11 115820411 missense probably benign 0.22
R4179:Tsen54 UTSW 11 115820852 missense probably damaging 0.99
R4521:Tsen54 UTSW 11 115817106 critical splice donor site probably null
R4618:Tsen54 UTSW 11 115815421 unclassified probably benign
R5485:Tsen54 UTSW 11 115815222 missense probably benign 0.15
R6111:Tsen54 UTSW 11 115820130 missense possibly damaging 0.82
R6238:Tsen54 UTSW 11 115820687 missense probably benign 0.02
R6459:Tsen54 UTSW 11 115821680 missense probably damaging 1.00
R6555:Tsen54 UTSW 11 115820693 missense probably benign 0.43
R7378:Tsen54 UTSW 11 115821705 missense probably benign 0.19
R7520:Tsen54 UTSW 11 115820971 missense probably damaging 0.99
X0028:Tsen54 UTSW 11 115817099 missense possibly damaging 0.50
Z1176:Tsen54 UTSW 11 115820578 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCCTGTGACACTGCTTTGTAG -3'
(R):5'- GCCCAGGACTTAGGTGAAAG -3'

Sequencing Primer
(F):5'- GGAGAGGAGAGTCCTTATCTT -3'
(R):5'- GATCTTGGGTTCCCATGGCAC -3'
Posted On2014-10-30