Mutagenetix > Incidental Mutation

Incidental Mutation 'R2300:Xdh'

245316

Institutional Source

Beutler Lab

Gene Symbol

Xdh

Ensembl Gene

ENSMUSG00000024066

Gene Name

xanthine dehydrogenase

Synonyms

xanthine oxidase, XO, Xor, Xox1, Xox-1

MMRRC Submission

040299-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.356) question?

Stock #

R2300 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

73883908-73950182 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 73891265 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 1209 (F1209S)

Ref Sequence

ENSEMBL: ENSMUSP00000024866 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024866]

AlphaFold

Q00519

Predicted Effect

probably damaging
Transcript: ENSMUST00000024866
AA Change: F1209S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: F1209S

Domain	Start	End	E-Value	Type
Pfam:Fer2	11	81	5e-12	PFAM
Pfam:Fer2_2	90	163	4.1e-31	PFAM
low complexity region	169	182	N/A	INTRINSIC
Pfam:FAD_binding_5	234	414	4.9e-47	PFAM
CO_deh_flav_C	421	525	1.16e-24	SMART
Ald_Xan_dh_C	590	696	1.23e-46	SMART
Pfam:Ald_Xan_dh_C2	704	1239	1e-200	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl1	G	T	8: 83,930,117	E355*	probably null	Het
Aldh6a1	G	T	12: 84,439,529	T205N	probably damaging	Het
Arhgap24	A	G	5: 102,860,425	I71V	probably damaging	Het
Arid2	A	T	15: 96,402,006	E1800V	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Cd53	T	C	3: 106,763,256	T154A	probably benign	Het
Chd7	G	A	4: 8,855,241	A2157T	probably benign	Het
Clca4b	A	T	3: 144,916,671	N544K	probably benign	Het
Cntrl	A	G	2: 35,127,513	E444G	probably benign	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Gabrr1	A	G	4: 33,152,449	K130E	probably benign	Het
H3f3a	C	T	1: 180,803,138	R117H	probably benign	Het
Jag1	T	C	2: 137,096,315	Y255C	probably damaging	Het
Kif11	A	G	19: 37,411,539	T825A	probably benign	Het
Lama4	T	A	10: 39,087,320	M1296K	probably benign	Het
Lrp1	G	T	10: 127,556,915	C2760*	probably null	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Nolc1	CAG	CAGAAG	19: 46,081,359		probably benign	Het
Nolc1	CAG	CAGTAG	19: 46,081,368		probably benign	Het
Nop16	A	G	13: 54,585,866		probably null	Het
Olfr134	T	A	17: 38,175,550	Y155*	probably null	Het
Olfr992	T	C	2: 85,400,132	I134V	probably benign	Het
Ostf1	T	C	19: 18,581,280	D213G	probably damaging	Het
Slc28a2	C	T	2: 122,441,778	Q34*	probably null	Het
St18	A	G	1: 6,855,402	D928G	probably damaging	Het
Stag1	T	C	9: 100,712,500	V31A	possibly damaging	Het
Tcl1b1	G	A	12: 105,164,524	A89T	probably benign	Het
Tsen54	A	T	11: 115,822,078	S464C	probably damaging	Het
Ttn	A	G	2: 76,907,448	F4249S	probably benign	Het
Ylpm1	G	A	12: 85,060,319		probably null	Het

Other mutations in Xdh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:Xdh	APN	17	73923106	missense	possibly damaging	0.58
IGL00556:Xdh	APN	17	73884435	makesense	probably null
IGL01524:Xdh	APN	17	73923137	critical splice acceptor site	probably null
IGL01604:Xdh	APN	17	73909337	missense	probably benign	0.02
IGL01625:Xdh	APN	17	73916786	critical splice donor site	probably null
IGL01778:Xdh	APN	17	73900280	missense	probably benign	0.00
IGL01804:Xdh	APN	17	73892759	missense	probably damaging	1.00
IGL01825:Xdh	APN	17	73891245	missense	probably damaging	1.00
IGL01929:Xdh	APN	17	73934855	missense	probably damaging	1.00
IGL02068:Xdh	APN	17	73913950	missense	probably damaging	1.00
IGL02079:Xdh	APN	17	73891277	missense	probably damaging	1.00
IGL02210:Xdh	APN	17	73943895	missense	probably benign	0.00
IGL02261:Xdh	APN	17	73913965	missense	possibly damaging	0.81
IGL02365:Xdh	APN	17	73943890	missense	probably benign	0.14
IGL02424:Xdh	APN	17	73926570	missense	probably benign	0.00
IGL02491:Xdh	APN	17	73886464	missense	probably damaging	0.99
IGL02525:Xdh	APN	17	73924995	missense	possibly damaging	0.91
IGL02578:Xdh	APN	17	73906246	missense	probably damaging	1.00
IGL02793:Xdh	APN	17	73900581	missense	probably damaging	1.00
IGL02939:Xdh	APN	17	73943845	critical splice donor site	probably null
IGL03327:Xdh	APN	17	73916792	missense	probably benign
IGL03345:Xdh	APN	17	73906032	missense	probably damaging	0.98
IGL03353:Xdh	APN	17	73895786	missense	possibly damaging	0.65
inky	UTSW	17	73921351	missense	probably damaging	1.00
nucleus	UTSW	17	73899012	nonsense	probably null
squidgame	UTSW	17	73939836	missense	probably benign
R0018:Xdh	UTSW	17	73925025	missense	probably benign	0.00
R0018:Xdh	UTSW	17	73925025	missense	probably benign	0.00
R0033:Xdh	UTSW	17	73907632	missense	probably benign	0.06
R0079:Xdh	UTSW	17	73891218	missense	probably damaging	1.00
R0086:Xdh	UTSW	17	73884438	missense	probably benign
R0319:Xdh	UTSW	17	73906101	splice site	probably benign
R0336:Xdh	UTSW	17	73922463	missense	possibly damaging	0.91
R0389:Xdh	UTSW	17	73898362	missense	probably damaging	1.00
R0684:Xdh	UTSW	17	73943891	missense	probably damaging	0.97
R0930:Xdh	UTSW	17	73923082	missense	probably benign	0.00
R1073:Xdh	UTSW	17	73939836	missense	probably benign
R1114:Xdh	UTSW	17	73941149	splice site	probably benign
R1201:Xdh	UTSW	17	73918418	missense	probably benign	0.05
R1230:Xdh	UTSW	17	73891256	missense	probably damaging	1.00
R1351:Xdh	UTSW	17	73923078	missense	probably benign	0.02
R1470:Xdh	UTSW	17	73891112	missense	probably damaging	1.00
R1470:Xdh	UTSW	17	73891112	missense	probably damaging	1.00
R1485:Xdh	UTSW	17	73914019	nonsense	probably null
R1548:Xdh	UTSW	17	73913901	missense	probably damaging	0.98
R1637:Xdh	UTSW	17	73900578	missense	probably benign
R1641:Xdh	UTSW	17	73926552	missense	probably benign
R1758:Xdh	UTSW	17	73910209	missense	probably damaging	1.00
R1951:Xdh	UTSW	17	73907658	missense	probably damaging	1.00
R1969:Xdh	UTSW	17	73892751	missense	possibly damaging	0.55
R2024:Xdh	UTSW	17	73921305	missense	possibly damaging	0.92
R2080:Xdh	UTSW	17	73909325	missense	probably damaging	1.00
R2157:Xdh	UTSW	17	73922537	missense	probably damaging	1.00
R3783:Xdh	UTSW	17	73893595	splice site	probably benign
R3796:Xdh	UTSW	17	73907658	missense	probably damaging	1.00
R3797:Xdh	UTSW	17	73907658	missense	probably damaging	1.00
R3798:Xdh	UTSW	17	73907658	missense	probably damaging	1.00
R3799:Xdh	UTSW	17	73907658	missense	probably damaging	1.00
R3819:Xdh	UTSW	17	73906725	missense	probably benign	0.35
R4085:Xdh	UTSW	17	73916879	missense	probably benign	0.35
R4240:Xdh	UTSW	17	73895795	missense	possibly damaging	0.72
R4356:Xdh	UTSW	17	73915690	missense	probably benign	0.01
R4522:Xdh	UTSW	17	73898344	missense	probably damaging	1.00
R4523:Xdh	UTSW	17	73898344	missense	probably damaging	1.00
R4524:Xdh	UTSW	17	73898344	missense	probably damaging	1.00
R4600:Xdh	UTSW	17	73910200	missense	probably benign	0.19
R4617:Xdh	UTSW	17	73918394	missense	probably damaging	0.99
R4756:Xdh	UTSW	17	73886386	missense	probably benign	0.24
R4761:Xdh	UTSW	17	73910267	missense	possibly damaging	0.91
R4815:Xdh	UTSW	17	73906215	missense	probably damaging	1.00
R4850:Xdh	UTSW	17	73898335	missense	probably damaging	1.00
R4896:Xdh	UTSW	17	73910243	missense	probably damaging	0.96
R4897:Xdh	UTSW	17	73900708	missense	probably benign
R4923:Xdh	UTSW	17	73924936	missense	possibly damaging	0.72
R4977:Xdh	UTSW	17	73898970	missense	probably benign	0.05
R5030:Xdh	UTSW	17	73891293	missense	probably damaging	1.00
R5185:Xdh	UTSW	17	73925011	missense	probably damaging	1.00
R5347:Xdh	UTSW	17	73925032	missense	probably benign
R5556:Xdh	UTSW	17	73897764	missense	probably benign	0.21
R5566:Xdh	UTSW	17	73893622	missense	probably damaging	1.00
R5568:Xdh	UTSW	17	73943885	missense	possibly damaging	0.90
R5635:Xdh	UTSW	17	73913875	missense	possibly damaging	0.92
R5662:Xdh	UTSW	17	73941115	missense	probably damaging	0.99
R5955:Xdh	UTSW	17	73898320	missense	probably damaging	1.00
R6058:Xdh	UTSW	17	73906269	missense	probably damaging	1.00
R6061:Xdh	UTSW	17	73921347	missense	probably damaging	1.00
R6412:Xdh	UTSW	17	73935907	missense	probably benign	0.09
R6526:Xdh	UTSW	17	73900551	missense	probably damaging	0.97
R6558:Xdh	UTSW	17	73893713	missense	possibly damaging	0.95
R6843:Xdh	UTSW	17	73923130	missense	probably damaging	1.00
R6932:Xdh	UTSW	17	73922562	missense	probably damaging	0.99
R7028:Xdh	UTSW	17	73943873	missense	probably damaging	0.99
R7418:Xdh	UTSW	17	73913965	missense	possibly damaging	0.81
R7503:Xdh	UTSW	17	73926210	missense	probably damaging	1.00
R7653:Xdh	UTSW	17	73897045	missense	probably benign	0.10
R7763:Xdh	UTSW	17	73934834	missense	possibly damaging	0.69
R7768:Xdh	UTSW	17	73939836	missense	probably benign
R7904:Xdh	UTSW	17	73922472	missense	probably benign	0.09
R8010:Xdh	UTSW	17	73909317	nonsense	probably null
R8067:Xdh	UTSW	17	73900657	missense	probably benign	0.01
R8238:Xdh	UTSW	17	73886417	missense	probably benign
R8253:Xdh	UTSW	17	73918382	missense	possibly damaging	0.94
R8346:Xdh	UTSW	17	73913943	missense	probably damaging	1.00
R8350:Xdh	UTSW	17	73934842	missense	probably damaging	1.00
R8381:Xdh	UTSW	17	73912461	missense	probably benign
R8427:Xdh	UTSW	17	73935931	missense	probably damaging	1.00
R8465:Xdh	UTSW	17	73899012	nonsense	probably null
R8478:Xdh	UTSW	17	73906058	missense	probably benign	0.00
R8680:Xdh	UTSW	17	73922505	missense	probably benign
R8802:Xdh	UTSW	17	73918410	missense	probably benign	0.00
R8984:Xdh	UTSW	17	73921351	missense	probably damaging	1.00
R8985:Xdh	UTSW	17	73921351	missense	probably damaging	1.00
R8995:Xdh	UTSW	17	73898374	missense	probably damaging	1.00
R9035:Xdh	UTSW	17	73910227	missense	probably benign
R9149:Xdh	UTSW	17	73915693	missense	probably benign
R9181:Xdh	UTSW	17	73925011	missense	probably damaging	1.00
R9357:Xdh	UTSW	17	73907716	missense	probably damaging	0.97
R9357:Xdh	UTSW	17	73926546	critical splice donor site	probably null
R9609:Xdh	UTSW	17	73924995	missense	possibly damaging	0.91
R9803:Xdh	UTSW	17	73922460	missense	probably benign
X0019:Xdh	UTSW	17	73918454	missense	probably damaging	1.00
Z1088:Xdh	UTSW	17	73886428	missense	probably benign
Z1176:Xdh	UTSW	17	73923042	critical splice donor site	probably null
Z1177:Xdh	UTSW	17	73897695	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGTGGTCTCCCTTCCTAAAG -3'
(R):5'- GAGACCAAGTTCAGTGACAATCC -3'

Sequencing Primer
(F):5'- CTCCCTTCCTAAAGTTTAGAAGGCAG -3'
(R):5'- TCCAATAGGGAGGCCTTGGTC -3'

Posted On

2014-10-30