Incidental Mutation 'R2311:Olfr1164'
ID245328
Institutional Source Beutler Lab
Gene Symbol Olfr1164
Ensembl Gene ENSMUSG00000075136
Gene Nameolfactory receptor 1164
SynonymsMOR174-11, GA_x6K02T2Q125-49585842-49584862
MMRRC Submission 040310-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R2311 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88092855-88093966 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88093834 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 34 (N34S)
Ref Sequence ENSEMBL: ENSMUSP00000097422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099834]
Predicted Effect probably benign
Transcript: ENSMUST00000099834
AA Change: N34S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097422
Gene: ENSMUSG00000075136
AA Change: N34S

DomainStartEndE-ValueType
Pfam:7tm_4 43 320 3.8e-47 PFAM
Pfam:7tm_1 53 302 2.9e-15 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7e G A 15: 77,718,036 R278H probably benign Het
Arhgef17 A G 7: 100,928,904 S946P probably benign Het
Capsl A T 15: 9,462,603 R110* probably null Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dock8 T A 19: 25,183,004 I1757N possibly damaging Het
Dthd1 T C 5: 62,839,237 probably benign Het
Eif5a2 A G 3: 28,782,176 E42G possibly damaging Het
Elovl3 A G 19: 46,133,200 S61G probably benign Het
Elp4 T C 2: 105,842,332 N136S probably benign Het
Elp6 A G 9: 110,320,818 S223G probably benign Het
Eml1 T A 12: 108,537,416 D743E probably damaging Het
Ezh2 T C 6: 47,558,260 Q85R probably damaging Het
Fermt3 C A 19: 7,014,162 C194F probably damaging Het
Flg A G 3: 93,292,953 probably benign Het
Gfi1b C T 2: 28,610,174 G282R probably damaging Het
Gm8979 T C 7: 106,083,590 K153E probably damaging Het
Gpr176 A T 2: 118,279,446 I444K probably benign Het
Gys2 A T 6: 142,463,244 M95K possibly damaging Het
Hgs C T 11: 120,479,648 R167W probably damaging Het
Map3k20 T C 2: 72,368,440 I130T probably damaging Het
Nckap5 A T 1: 126,528,752 Y25N probably damaging Het
Npc1 C T 18: 12,202,183 V629I probably benign Het
Nrl C A 14: 55,522,452 S6I probably damaging Het
Olfr1209 T A 2: 88,909,469 D308V probably benign Het
Olfr1349 A T 7: 6,514,742 M229K probably benign Het
Oxct2b T C 4: 123,117,418 F377S probably damaging Het
Plb1 T C 5: 32,269,818 S91P probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Postn A T 3: 54,385,223 Y737F probably damaging Het
Serpina1e T A 12: 103,951,129 I94F possibly damaging Het
Serpine2 A G 1: 79,810,548 probably benign Het
Stox2 T C 8: 47,191,978 R816G probably damaging Het
Tep1 T C 14: 50,833,567 N2092D possibly damaging Het
Tmem186 A G 16: 8,635,884 V171A probably benign Het
Trim58 G A 11: 58,643,108 V163M probably benign Het
Trim59 G T 3: 69,037,829 C59* probably null Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vill A G 9: 119,065,897 N61S probably benign Het
Zer1 C T 2: 30,101,822 R662H probably damaging Het
Zfp644 A C 5: 106,634,956 V1184G probably benign Het
Zfp974 A G 7: 27,910,441 S620P possibly damaging Het
Other mutations in Olfr1164
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Olfr1164 APN 2 88093016 missense possibly damaging 0.48
IGL02894:Olfr1164 APN 2 88093763 missense possibly damaging 0.79
IGL02977:Olfr1164 APN 2 88093571 missense probably benign
R0234:Olfr1164 UTSW 2 88093022 nonsense probably null
R0234:Olfr1164 UTSW 2 88093022 nonsense probably null
R0480:Olfr1164 UTSW 2 88093628 missense probably benign
R0644:Olfr1164 UTSW 2 88093289 missense probably benign 0.02
R1479:Olfr1164 UTSW 2 88093286 missense probably benign 0.05
R2047:Olfr1164 UTSW 2 88093893 missense probably benign 0.01
R2973:Olfr1164 UTSW 2 88093114 missense probably benign 0.00
R3683:Olfr1164 UTSW 2 88093259 missense probably damaging 1.00
R3685:Olfr1164 UTSW 2 88093259 missense probably damaging 1.00
R4258:Olfr1164 UTSW 2 88093018 missense probably damaging 1.00
R4811:Olfr1164 UTSW 2 88093532 missense probably benign 0.08
R4970:Olfr1164 UTSW 2 88093009 missense probably damaging 1.00
R5112:Olfr1164 UTSW 2 88093009 missense probably damaging 1.00
R5258:Olfr1164 UTSW 2 88093418 missense probably benign 0.22
R5884:Olfr1164 UTSW 2 88093796 missense probably damaging 1.00
R6329:Olfr1164 UTSW 2 88093664 missense probably damaging 1.00
R6597:Olfr1164 UTSW 2 88093069 missense probably damaging 1.00
R7018:Olfr1164 UTSW 2 88093256 missense probably benign 0.00
R7055:Olfr1164 UTSW 2 88093701 missense probably damaging 1.00
R7314:Olfr1164 UTSW 2 88093114 missense probably benign 0.00
R7350:Olfr1164 UTSW 2 88093198 missense probably benign 0.01
R7527:Olfr1164 UTSW 2 88093610 missense probably damaging 1.00
R8003:Olfr1164 UTSW 2 88093245 nonsense probably null
Z1176:Olfr1164 UTSW 2 88093334 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGCCATGCATCCTTCAAAG -3'
(R):5'- TACATGACTTCCCCGTGACG -3'

Sequencing Primer
(F):5'- CAAGAGGTCTAACAGCTTTGGTGC -3'
(R):5'- TGACGTCTCTTGGAGGCC -3'
Posted On2014-10-30