Incidental Mutation 'R2311:Elp4'
ID245330
Institutional Source Beutler Lab
Gene Symbol Elp4
Ensembl Gene ENSMUSG00000027167
Gene Nameelongator acetyltransferase complex subunit 4
SynonymsA330107A17Rik, Paxneb
MMRRC Submission 040310-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R2311 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location105701027-105904564 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105842332 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 136 (N136S)
Ref Sequence ENSEMBL: ENSMUSP00000116575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028588] [ENSMUST00000122965]
Predicted Effect probably benign
Transcript: ENSMUST00000028588
AA Change: N18S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000028588
Gene: ENSMUSG00000027167
AA Change: N18S

DomainStartEndE-ValueType
Pfam:PAXNEB 2 270 9.1e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122965
AA Change: N136S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000116575
Gene: ENSMUSG00000027167
AA Change: N136S

DomainStartEndE-ValueType
Pfam:PAXNEB 28 422 4e-123 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the six subunit elongator complex, a histone acetyltransferase complex that associates directly with RNA polymerase II during transcriptional elongation. The human gene can partially complement sensitivity phenotypes of yeast ELP4 deletion mutants. This gene has also been associated with Rolandic epilepsy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7e G A 15: 77,718,036 R278H probably benign Het
Arhgef17 A G 7: 100,928,904 S946P probably benign Het
Capsl A T 15: 9,462,603 R110* probably null Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dock8 T A 19: 25,183,004 I1757N possibly damaging Het
Dthd1 T C 5: 62,839,237 probably benign Het
Eif5a2 A G 3: 28,782,176 E42G possibly damaging Het
Elovl3 A G 19: 46,133,200 S61G probably benign Het
Elp6 A G 9: 110,320,818 S223G probably benign Het
Eml1 T A 12: 108,537,416 D743E probably damaging Het
Ezh2 T C 6: 47,558,260 Q85R probably damaging Het
Fermt3 C A 19: 7,014,162 C194F probably damaging Het
Flg A G 3: 93,292,953 probably benign Het
Gfi1b C T 2: 28,610,174 G282R probably damaging Het
Gm8979 T C 7: 106,083,590 K153E probably damaging Het
Gpr176 A T 2: 118,279,446 I444K probably benign Het
Gys2 A T 6: 142,463,244 M95K possibly damaging Het
Hgs C T 11: 120,479,648 R167W probably damaging Het
Map3k20 T C 2: 72,368,440 I130T probably damaging Het
Nckap5 A T 1: 126,528,752 Y25N probably damaging Het
Npc1 C T 18: 12,202,183 V629I probably benign Het
Nrl C A 14: 55,522,452 S6I probably damaging Het
Olfr1164 T C 2: 88,093,834 N34S probably benign Het
Olfr1209 T A 2: 88,909,469 D308V probably benign Het
Olfr1349 A T 7: 6,514,742 M229K probably benign Het
Oxct2b T C 4: 123,117,418 F377S probably damaging Het
Plb1 T C 5: 32,269,818 S91P probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Postn A T 3: 54,385,223 Y737F probably damaging Het
Serpina1e T A 12: 103,951,129 I94F possibly damaging Het
Serpine2 A G 1: 79,810,548 probably benign Het
Stox2 T C 8: 47,191,978 R816G probably damaging Het
Tep1 T C 14: 50,833,567 N2092D possibly damaging Het
Tmem186 A G 16: 8,635,884 V171A probably benign Het
Trim58 G A 11: 58,643,108 V163M probably benign Het
Trim59 G T 3: 69,037,829 C59* probably null Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vill A G 9: 119,065,897 N61S probably benign Het
Zer1 C T 2: 30,101,822 R662H probably damaging Het
Zfp644 A C 5: 106,634,956 V1184G probably benign Het
Zfp974 A G 7: 27,910,441 S620P possibly damaging Het
Other mutations in Elp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Elp4 APN 2 105842366 splice site probably benign
IGL01407:Elp4 APN 2 105792308 missense probably damaging 1.00
IGL02173:Elp4 APN 2 105702743 missense probably damaging 0.96
IGL02370:Elp4 APN 2 105794592 missense probably damaging 1.00
R0125:Elp4 UTSW 2 105792214 critical splice donor site probably null
R0685:Elp4 UTSW 2 105792277 missense possibly damaging 0.94
R0893:Elp4 UTSW 2 105896945 splice site probably benign
R1117:Elp4 UTSW 2 105842311 missense probably benign 0.00
R1496:Elp4 UTSW 2 105832161 missense probably benign 0.31
R1542:Elp4 UTSW 2 105794609 missense probably benign 0.02
R1911:Elp4 UTSW 2 105702743 missense probably damaging 0.96
R2997:Elp4 UTSW 2 105814316 missense possibly damaging 0.82
R3079:Elp4 UTSW 2 105809445 missense possibly damaging 0.95
R3683:Elp4 UTSW 2 105702761 missense possibly damaging 0.75
R4747:Elp4 UTSW 2 105794607 missense probably damaging 1.00
R4799:Elp4 UTSW 2 105809267 missense probably damaging 0.99
R5438:Elp4 UTSW 2 105904403 missense probably damaging 1.00
R5635:Elp4 UTSW 2 105814264 critical splice donor site probably null
R6414:Elp4 UTSW 2 105904443 missense possibly damaging 0.94
R7228:Elp4 UTSW 2 105792302 missense probably damaging 1.00
R7381:Elp4 UTSW 2 105792307 missense not run
R7560:Elp4 UTSW 2 105794588 missense probably damaging 1.00
R7671:Elp4 UTSW 2 105904481 missense probably damaging 0.99
R8376:Elp4 UTSW 2 105842308 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTAGTAATGCAAAGCAGAGATTC -3'
(R):5'- TACATAGGACACCTGTCAGAAAG -3'

Sequencing Primer
(F):5'- TGCATGCTGACTTACCTC -3'
(R):5'- CATAGGACACCTGTCAGAAAGGAAAG -3'
Posted On2014-10-30