Incidental Mutation 'R2311:Gpr176'
ID245331
Institutional Source Beutler Lab
Gene Symbol Gpr176
Ensembl Gene ENSMUSG00000040133
Gene NameG protein-coupled receptor 176
SynonymsLOC381413
MMRRC Submission 040310-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2311 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location118277110-118373419 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118279446 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 444 (I444K)
Ref Sequence ENSEMBL: ENSMUSP00000037586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039160]
Predicted Effect probably benign
Transcript: ENSMUST00000039160
AA Change: I444K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037586
Gene: ENSMUSG00000040133
AA Change: I444K

DomainStartEndE-ValueType
Pfam:7tm_1 57 319 1.5e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189100
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the G protein-coupled receptor family, such as GPR176, are cell surface receptors involved in responses to hormones, growth factors, and neurotransmitters (Hata et al., 1995 [PubMed 7893747]).[supplied by OMIM, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7e G A 15: 77,718,036 R278H probably benign Het
Arhgef17 A G 7: 100,928,904 S946P probably benign Het
Capsl A T 15: 9,462,603 R110* probably null Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dock8 T A 19: 25,183,004 I1757N possibly damaging Het
Dthd1 T C 5: 62,839,237 probably benign Het
Eif5a2 A G 3: 28,782,176 E42G possibly damaging Het
Elovl3 A G 19: 46,133,200 S61G probably benign Het
Elp4 T C 2: 105,842,332 N136S probably benign Het
Elp6 A G 9: 110,320,818 S223G probably benign Het
Eml1 T A 12: 108,537,416 D743E probably damaging Het
Ezh2 T C 6: 47,558,260 Q85R probably damaging Het
Fermt3 C A 19: 7,014,162 C194F probably damaging Het
Flg A G 3: 93,292,953 probably benign Het
Gfi1b C T 2: 28,610,174 G282R probably damaging Het
Gm8979 T C 7: 106,083,590 K153E probably damaging Het
Gys2 A T 6: 142,463,244 M95K possibly damaging Het
Hgs C T 11: 120,479,648 R167W probably damaging Het
Map3k20 T C 2: 72,368,440 I130T probably damaging Het
Nckap5 A T 1: 126,528,752 Y25N probably damaging Het
Npc1 C T 18: 12,202,183 V629I probably benign Het
Nrl C A 14: 55,522,452 S6I probably damaging Het
Olfr1164 T C 2: 88,093,834 N34S probably benign Het
Olfr1209 T A 2: 88,909,469 D308V probably benign Het
Olfr1349 A T 7: 6,514,742 M229K probably benign Het
Oxct2b T C 4: 123,117,418 F377S probably damaging Het
Plb1 T C 5: 32,269,818 S91P probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Postn A T 3: 54,385,223 Y737F probably damaging Het
Serpina1e T A 12: 103,951,129 I94F possibly damaging Het
Serpine2 A G 1: 79,810,548 probably benign Het
Stox2 T C 8: 47,191,978 R816G probably damaging Het
Tep1 T C 14: 50,833,567 N2092D possibly damaging Het
Tmem186 A G 16: 8,635,884 V171A probably benign Het
Trim58 G A 11: 58,643,108 V163M probably benign Het
Trim59 G T 3: 69,037,829 C59* probably null Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vill A G 9: 119,065,897 N61S probably benign Het
Zer1 C T 2: 30,101,822 R662H probably damaging Het
Zfp644 A C 5: 106,634,956 V1184G probably benign Het
Zfp974 A G 7: 27,910,441 S620P possibly damaging Het
Other mutations in Gpr176
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01969:Gpr176 APN 2 118279637 missense probably damaging 0.99
R0334:Gpr176 UTSW 2 118279708 missense probably benign
R0483:Gpr176 UTSW 2 118279723 missense probably damaging 0.99
R0522:Gpr176 UTSW 2 118284012 missense probably damaging 1.00
R0784:Gpr176 UTSW 2 118373052 missense possibly damaging 0.57
R1565:Gpr176 UTSW 2 118280214 missense probably benign
R1860:Gpr176 UTSW 2 118373178 missense probably damaging 1.00
R2029:Gpr176 UTSW 2 118279432 missense probably benign 0.02
R3935:Gpr176 UTSW 2 118279296 missense probably benign
R4241:Gpr176 UTSW 2 118279610 missense probably benign 0.22
R5112:Gpr176 UTSW 2 118280148 missense possibly damaging 0.88
R5927:Gpr176 UTSW 2 118373040 missense probably benign 0.03
R5996:Gpr176 UTSW 2 118283904 critical splice donor site probably null
R8172:Gpr176 UTSW 2 118284134 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTGCTAGGAGTCTACCTTTGG -3'
(R):5'- TTTAAGCCCTCGGAGGATGAG -3'

Sequencing Primer
(F):5'- GGAGTCTACCTTTGGAAAAATGCTC -3'
(R):5'- GGAAGAAAGTGAGGCCAAGTATCTC -3'
Posted On2014-10-30