Incidental Mutation 'R2313:Olfr1228'
ID245367
Institutional Source Beutler Lab
Gene Symbol Olfr1228
Ensembl Gene ENSMUSG00000099486
Gene Nameolfactory receptor 1228
SynonymsMOR233-1, GA_x6K02T2Q125-50696209-50695274
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R2313 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location89247964-89254062 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 89248941 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 239 (C239F)
Ref Sequence ENSEMBL: ENSMUSP00000150633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099789] [ENSMUST00000190757] [ENSMUST00000215447] [ENSMUST00000216392]
Predicted Effect probably damaging
Transcript: ENSMUST00000099789
AA Change: C251F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097377
Gene: ENSMUSG00000101480
AA Change: C251F

DomainStartEndE-ValueType
Pfam:7tm_4 41 315 4.2e-48 PFAM
Pfam:7tm_1 51 298 4.1e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190757
AA Change: C251F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139920
Gene: ENSMUSG00000099486
AA Change: C251F

DomainStartEndE-ValueType
Pfam:7tm_1 51 298 2.6e-27 PFAM
Pfam:7tm_4 150 292 2.9e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215447
AA Change: C239F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216392
AA Change: C239F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 T A 6: 116,413,861 D443V probably benign Het
Ankrd53 A T 6: 83,763,680 H95L probably damaging Het
Chrnb3 A G 8: 27,393,781 Y182C probably damaging Het
Cln5 C T 14: 103,071,746 R79* probably null Het
Cntn3 C A 6: 102,203,928 V769L probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Il1r1 T C 1: 40,313,310 S550P probably benign Het
Klra7 T A 6: 130,228,542 T132S probably benign Het
Lrch3 A G 16: 32,961,675 N273S probably damaging Het
Lrriq3 A T 3: 155,164,023 R328S probably benign Het
Mpp2 T C 11: 102,062,072 E318G possibly damaging Het
Olfr732 G A 14: 50,281,974 S93F probably damaging Het
Pglyrp2 A T 17: 32,418,699 D118E probably damaging Het
Ppp4c A G 7: 126,787,457 S153P probably damaging Het
Ptpn13 A G 5: 103,564,161 S1642G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Unc13d A G 11: 116,063,734 F1016S probably damaging Het
Vwa8 C G 14: 78,912,218 T140S probably damaging Het
Wdfy3 A G 5: 101,889,284 F2046L probably damaging Het
Zfp788 A G 7: 41,648,888 H316R probably damaging Het
Zfp994 T A 17: 22,201,285 I228F probably damaging Het
Other mutations in Olfr1228
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01804:Olfr1228 APN 2 89249222 missense probably benign 0.00
IGL02588:Olfr1228 APN 2 89249698 splice site probably benign
R0384:Olfr1228 UTSW 2 89249070 missense possibly damaging 0.82
R0600:Olfr1228 UTSW 2 89249398 nonsense probably null
R0613:Olfr1228 UTSW 2 89249125 missense probably damaging 1.00
R1564:Olfr1228 UTSW 2 89249672 missense probably benign 0.00
R2115:Olfr1228 UTSW 2 89249530 missense probably damaging 1.00
R3083:Olfr1228 UTSW 2 89249001 missense probably damaging 0.96
R3790:Olfr1228 UTSW 2 89248993 missense probably benign 0.02
R3948:Olfr1228 UTSW 2 89248992 missense possibly damaging 0.95
R4373:Olfr1228 UTSW 2 89249245 missense possibly damaging 0.90
R4376:Olfr1228 UTSW 2 89249245 missense possibly damaging 0.90
R4825:Olfr1228 UTSW 2 89248690 utr 3 prime probably null
R5022:Olfr1228 UTSW 2 89249417 missense probably benign 0.00
R5141:Olfr1228 UTSW 2 89249129 nonsense probably null
R5313:Olfr1228 UTSW 2 89249377 missense probably benign 0.05
R6010:Olfr1228 UTSW 2 89248743 missense probably benign 0.00
R7354:Olfr1228 UTSW 2 89248687 utr 3 prime probably null
R7548:Olfr1228 UTSW 2 89249086 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TTTTGGGAAGAGACCTTGGC -3'
(R):5'- TTACTGAAGCTTGCCTGCAC -3'

Sequencing Primer
(F):5'- GCATAACAAATGTTCTTACCCACTGG -3'
(R):5'- GAAGCTTGCCTGCACTGACAC -3'
Posted On2014-10-30