Incidental Mutation 'R2313:Lrriq3'
ID245368
Institutional Source Beutler Lab
Gene Symbol Lrriq3
Ensembl Gene ENSMUSG00000028182
Gene Nameleucine-rich repeats and IQ motif containing 3
Synonyms4930511J15Rik, 4930438B07Rik, 4933403H06Rik, Lrrc44
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R2313 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location155093434-155194280 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 155164023 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 328 (R328S)
Ref Sequence ENSEMBL: ENSMUSP00000141372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029833] [ENSMUST00000192383]
Predicted Effect probably benign
Transcript: ENSMUST00000029833
AA Change: R328S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000029833
Gene: ENSMUSG00000028182
AA Change: R328S

DomainStartEndE-ValueType
SCOP:d1dcea3 36 155 3e-14 SMART
Blast:LRR 71 94 3e-6 BLAST
Blast:LRR 96 118 1e-5 BLAST
IQ 214 236 3.68e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192383
AA Change: R328S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000141372
Gene: ENSMUSG00000028182
AA Change: R328S

DomainStartEndE-ValueType
Pfam:LRR_8 50 109 9e-9 PFAM
Pfam:LRR_4 72 117 1.9e-8 PFAM
Pfam:LRR_1 73 94 5.1e-3 PFAM
IQ 214 236 3.68e0 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 T A 6: 116,413,861 D443V probably benign Het
Ankrd53 A T 6: 83,763,680 H95L probably damaging Het
Chrnb3 A G 8: 27,393,781 Y182C probably damaging Het
Cln5 C T 14: 103,071,746 R79* probably null Het
Cntn3 C A 6: 102,203,928 V769L probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Il1r1 T C 1: 40,313,310 S550P probably benign Het
Klra7 T A 6: 130,228,542 T132S probably benign Het
Lrch3 A G 16: 32,961,675 N273S probably damaging Het
Mpp2 T C 11: 102,062,072 E318G possibly damaging Het
Olfr1228 C A 2: 89,248,941 C239F probably damaging Het
Olfr732 G A 14: 50,281,974 S93F probably damaging Het
Pglyrp2 A T 17: 32,418,699 D118E probably damaging Het
Ppp4c A G 7: 126,787,457 S153P probably damaging Het
Ptpn13 A G 5: 103,564,161 S1642G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Unc13d A G 11: 116,063,734 F1016S probably damaging Het
Vwa8 C G 14: 78,912,218 T140S probably damaging Het
Wdfy3 A G 5: 101,889,284 F2046L probably damaging Het
Zfp788 A G 7: 41,648,888 H316R probably damaging Het
Zfp994 T A 17: 22,201,285 I228F probably damaging Het
Other mutations in Lrriq3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Lrriq3 APN 3 155101061 missense probably benign 0.29
IGL00468:Lrriq3 APN 3 155101179 missense probably damaging 1.00
IGL03272:Lrriq3 APN 3 155101058 missense probably damaging 0.99
PIT1430001:Lrriq3 UTSW 3 155098870 missense probably benign 0.36
R0526:Lrriq3 UTSW 3 155188297 missense probably benign 0.00
R0600:Lrriq3 UTSW 3 155187736 missense possibly damaging 0.51
R1420:Lrriq3 UTSW 3 155187712 missense probably benign
R4024:Lrriq3 UTSW 3 155188302 missense probably benign 0.43
R4659:Lrriq3 UTSW 3 155129453 missense possibly damaging 0.47
R4801:Lrriq3 UTSW 3 155187970 missense probably benign
R4802:Lrriq3 UTSW 3 155187970 missense probably benign
R4864:Lrriq3 UTSW 3 155187810 missense possibly damaging 0.91
R4998:Lrriq3 UTSW 3 155188058 missense probably benign 0.13
R5120:Lrriq3 UTSW 3 155129384 missense probably benign 0.14
R5319:Lrriq3 UTSW 3 155129471 missense possibly damaging 0.88
R5406:Lrriq3 UTSW 3 155129501 critical splice donor site probably null
R5943:Lrriq3 UTSW 3 155163950 missense probably damaging 0.99
R6184:Lrriq3 UTSW 3 155129402 missense probably benign 0.09
R6572:Lrriq3 UTSW 3 155181675 missense probably benign 0.01
R7389:Lrriq3 UTSW 3 155188104 missense probably benign 0.00
R7537:Lrriq3 UTSW 3 155101097 missense probably damaging 1.00
R7636:Lrriq3 UTSW 3 155188150 missense probably damaging 1.00
R7806:Lrriq3 UTSW 3 155098807 missense probably damaging 0.99
R8038:Lrriq3 UTSW 3 155164001 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACCTGGAGTTGAGAGGCAAACT -3'
(R):5'- TTACTGAGGGCATGGTGGC -3'

Sequencing Primer
(F):5'- CATTTGTCAAAGTGTTTTATCACAGC -3'
(R):5'- GGTCTACAGAGTGAGTTCCAG -3'
Posted On2014-10-30