Mutagenetix > Incidental Mutation

Incidental Mutation 'R2313:Cntn3'

245372

Institutional Source

Beutler Lab

Gene Symbol

Cntn3

Ensembl Gene

ENSMUSG00000030075

Gene Name

contactin 3

Synonyms

Pang

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2313 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

102140265-102541575 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 102180889 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 769 (V769L)

Ref Sequence

ENSEMBL: ENSMUSP00000145176 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032159] [ENSMUST00000203619]

AlphaFold

Q07409

Predicted Effect

probably benign
Transcript: ENSMUST00000032159
AA Change: V769L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000032159
Gene: ENSMUSG00000030075
AA Change: V769L

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IGc2	41	107	1.85e-7	SMART
IG	129	217	1.82e-6	SMART
IGc2	240	304	6.8e-15	SMART
IGc2	330	393	1.74e-12	SMART
IGc2	422	486	1.53e-8	SMART
IG	506	595	5.2e-11	SMART
FN3	598	684	3.4e-13	SMART
FN3	701	787	5.36e-2	SMART
FN3	803	888	4.63e-6	SMART
FN3	903	983	1.07e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000203619
AA Change: V769L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000145176
Gene: ENSMUSG00000030075
AA Change: V769L

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IGc2	41	107	1.85e-7	SMART
IG	129	217	1.82e-6	SMART
IGc2	240	304	6.8e-15	SMART
IGc2	330	393	1.74e-12	SMART
IGc2	422	486	1.53e-8	SMART
IG	506	595	5.2e-11	SMART
FN3	598	684	3.4e-13	SMART
FN3	701	787	5.36e-2	SMART
FN3	803	888	4.63e-6	SMART
FN3	903	983	1.07e-1	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 21 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alox5	T	A	6: 116,390,822 (GRCm39)	D443V	probably benign	Het
Ankrd53	A	T	6: 83,740,662 (GRCm39)	H95L	probably damaging	Het
Chrnb3	A	G	8: 27,883,809 (GRCm39)	Y182C	probably damaging	Het
Cln5	C	T	14: 103,309,182 (GRCm39)	R79*	probably null	Het
Gpat4	G	A	8: 23,670,171 (GRCm39)	P286L	probably damaging	Het
Il1r1	T	C	1: 40,352,470 (GRCm39)	S550P	probably benign	Het
Klra7	T	A	6: 130,205,505 (GRCm39)	T132S	probably benign	Het
Lrch3	A	G	16: 32,782,045 (GRCm39)	N273S	probably damaging	Het
Lrriq3	A	T	3: 154,869,660 (GRCm39)	R328S	probably benign	Het
Mpp2	T	C	11: 101,952,898 (GRCm39)	E318G	possibly damaging	Het
Or4c122	C	A	2: 89,079,285 (GRCm39)	C239F	probably damaging	Het
Or4n4	G	A	14: 50,519,431 (GRCm39)	S93F	probably damaging	Het
Pglyrp2	A	T	17: 32,637,673 (GRCm39)	D118E	probably damaging	Het
Ppp4c	A	G	7: 126,386,629 (GRCm39)	S153P	probably damaging	Het
Ptpn13	A	G	5: 103,712,027 (GRCm39)	S1642G	probably damaging	Het
Tmem59l	A	G	8: 70,939,951 (GRCm39)	L6S	unknown	Het
Unc13d	A	G	11: 115,954,560 (GRCm39)	F1016S	probably damaging	Het
Vwa8	C	G	14: 79,149,658 (GRCm39)	T140S	probably damaging	Het
Wdfy3	A	G	5: 102,037,150 (GRCm39)	F2046L	probably damaging	Het
Zfp788	A	G	7: 41,298,312 (GRCm39)	H316R	probably damaging	Het
Zfp994	T	A	17: 22,420,266 (GRCm39)	I228F	probably damaging	Het

Other mutations in Cntn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00538:Cntn3	APN	6	102,397,223 (GRCm39)	nonsense	probably null
IGL00706:Cntn3	APN	6	102,180,910 (GRCm39)	missense	probably benign	0.11
IGL01071:Cntn3	APN	6	102,397,212 (GRCm39)	critical splice donor site	probably null
IGL01769:Cntn3	APN	6	102,185,145 (GRCm39)	missense	probably damaging	1.00
IGL01995:Cntn3	APN	6	102,180,846 (GRCm39)	missense	probably damaging	1.00
IGL02058:Cntn3	APN	6	102,176,321 (GRCm39)	splice site	probably benign
IGL02736:Cntn3	APN	6	102,180,900 (GRCm39)	missense	probably damaging	1.00
IGL02955:Cntn3	APN	6	102,255,262 (GRCm39)	missense	probably damaging	1.00
IGL02971:Cntn3	APN	6	102,145,894 (GRCm39)	missense	probably damaging	1.00
IGL03208:Cntn3	APN	6	102,164,060 (GRCm39)	missense	probably damaging	0.99
P0037:Cntn3	UTSW	6	102,186,235 (GRCm39)	missense	probably damaging	1.00
PIT4431001:Cntn3	UTSW	6	102,441,527 (GRCm39)	missense	probably benign	0.22
R0314:Cntn3	UTSW	6	102,397,342 (GRCm39)	missense	probably damaging	1.00
R0388:Cntn3	UTSW	6	102,254,277 (GRCm39)	missense	probably damaging	0.96
R0483:Cntn3	UTSW	6	102,180,927 (GRCm39)	missense	probably damaging	1.00
R0539:Cntn3	UTSW	6	102,254,178 (GRCm39)	critical splice donor site	probably null
R0543:Cntn3	UTSW	6	102,246,051 (GRCm39)	splice site	probably benign
R0629:Cntn3	UTSW	6	102,180,937 (GRCm39)	missense	probably damaging	1.00
R0691:Cntn3	UTSW	6	102,145,908 (GRCm39)	missense	possibly damaging	0.48
R0693:Cntn3	UTSW	6	102,145,908 (GRCm39)	missense	possibly damaging	0.48
R0781:Cntn3	UTSW	6	102,222,119 (GRCm39)	missense	probably benign	0.22
R1110:Cntn3	UTSW	6	102,222,119 (GRCm39)	missense	probably benign	0.22
R1144:Cntn3	UTSW	6	102,219,087 (GRCm39)	missense	possibly damaging	0.65
R1503:Cntn3	UTSW	6	102,441,526 (GRCm39)	nonsense	probably null
R1640:Cntn3	UTSW	6	102,218,974 (GRCm39)	missense	possibly damaging	0.82
R1681:Cntn3	UTSW	6	102,147,629 (GRCm39)	missense	probably damaging	1.00
R1770:Cntn3	UTSW	6	102,246,166 (GRCm39)	missense	possibly damaging	0.49
R1782:Cntn3	UTSW	6	102,250,772 (GRCm39)	missense	probably damaging	0.97
R1861:Cntn3	UTSW	6	102,222,032 (GRCm39)	missense	probably benign	0.11
R1930:Cntn3	UTSW	6	102,219,014 (GRCm39)	nonsense	probably null
R2026:Cntn3	UTSW	6	102,397,388 (GRCm39)	missense	probably damaging	1.00
R2152:Cntn3	UTSW	6	102,183,498 (GRCm39)	missense	probably damaging	1.00
R2351:Cntn3	UTSW	6	102,314,344 (GRCm39)	missense	possibly damaging	0.55
R3611:Cntn3	UTSW	6	102,185,038 (GRCm39)	missense	possibly damaging	0.77
R4349:Cntn3	UTSW	6	102,176,312 (GRCm39)	missense	probably damaging	1.00
R4421:Cntn3	UTSW	6	102,441,508 (GRCm39)	missense	probably damaging	0.97
R4513:Cntn3	UTSW	6	102,145,943 (GRCm39)	missense	probably benign	0.37
R4678:Cntn3	UTSW	6	102,180,981 (GRCm39)	missense	probably damaging	1.00
R4702:Cntn3	UTSW	6	102,142,292 (GRCm39)	missense	probably benign	0.37
R4720:Cntn3	UTSW	6	102,218,983 (GRCm39)	missense	possibly damaging	0.65
R4879:Cntn3	UTSW	6	102,244,389 (GRCm39)	missense	possibly damaging	0.47
R4951:Cntn3	UTSW	6	102,145,986 (GRCm39)	missense	possibly damaging	0.90
R5410:Cntn3	UTSW	6	102,255,314 (GRCm39)	missense	probably benign	0.01
R5502:Cntn3	UTSW	6	102,242,295 (GRCm39)	missense	possibly damaging	0.58
R5852:Cntn3	UTSW	6	102,397,377 (GRCm39)	missense	probably damaging	1.00
R5903:Cntn3	UTSW	6	102,219,094 (GRCm39)	missense	probably benign	0.00
R6193:Cntn3	UTSW	6	102,185,092 (GRCm39)	missense	probably benign	0.31
R6258:Cntn3	UTSW	6	102,254,178 (GRCm39)	critical splice donor site	probably null
R6260:Cntn3	UTSW	6	102,254,178 (GRCm39)	critical splice donor site	probably null
R6350:Cntn3	UTSW	6	102,147,579 (GRCm39)	missense	probably damaging	1.00
R6490:Cntn3	UTSW	6	102,255,301 (GRCm39)	missense	probably damaging	0.99
R6993:Cntn3	UTSW	6	102,255,365 (GRCm39)	missense	probably damaging	0.98
R7064:Cntn3	UTSW	6	102,250,772 (GRCm39)	missense	probably damaging	0.97
R7085:Cntn3	UTSW	6	102,142,362 (GRCm39)	missense	possibly damaging	0.85
R7174:Cntn3	UTSW	6	102,142,305 (GRCm39)	missense	probably benign
R7208:Cntn3	UTSW	6	102,255,383 (GRCm39)	nonsense	probably null
R7395:Cntn3	UTSW	6	102,314,355 (GRCm39)	critical splice acceptor site	probably null
R7447:Cntn3	UTSW	6	102,255,416 (GRCm39)	nonsense	probably null
R7571:Cntn3	UTSW	6	102,255,364 (GRCm39)	missense	probably damaging	1.00
R7586:Cntn3	UTSW	6	102,397,388 (GRCm39)	missense	probably damaging	1.00
R7614:Cntn3	UTSW	6	102,142,337 (GRCm39)	missense	probably benign	0.17
R7697:Cntn3	UTSW	6	102,185,128 (GRCm39)	missense	probably damaging	1.00
R7697:Cntn3	UTSW	6	102,185,127 (GRCm39)	missense	probably damaging	1.00
R7849:Cntn3	UTSW	6	102,242,392 (GRCm39)	missense	probably benign	0.00
R8011:Cntn3	UTSW	6	102,414,860 (GRCm39)	missense	possibly damaging	0.93
R8013:Cntn3	UTSW	6	102,176,278 (GRCm39)	missense	probably benign	0.00
R8377:Cntn3	UTSW	6	102,186,254 (GRCm39)	missense	probably benign	0.00
R8726:Cntn3	UTSW	6	102,146,014 (GRCm39)	nonsense	probably null
R8770:Cntn3	UTSW	6	102,254,277 (GRCm39)	missense	possibly damaging	0.67
R8827:Cntn3	UTSW	6	102,246,094 (GRCm39)	missense	probably benign	0.01
R8947:Cntn3	UTSW	6	102,414,864 (GRCm39)	missense	probably damaging	1.00
R8997:Cntn3	UTSW	6	102,181,023 (GRCm39)	missense	probably damaging	0.98
R9055:Cntn3	UTSW	6	102,244,398 (GRCm39)	missense	probably benign	0.38
R9061:Cntn3	UTSW	6	102,314,288 (GRCm39)	missense	probably damaging	1.00
R9758:Cntn3	UTSW	6	102,183,511 (GRCm39)	missense	probably damaging	1.00
R9762:Cntn3	UTSW	6	102,254,196 (GRCm39)	missense	probably damaging	1.00
Z1088:Cntn3	UTSW	6	102,397,255 (GRCm39)	missense	possibly damaging	0.74
Z1176:Cntn3	UTSW	6	102,414,892 (GRCm39)	critical splice acceptor site	probably null
Z1177:Cntn3	UTSW	6	102,314,292 (GRCm39)	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- AATCCTGGAGAGACTTGAGGTCC -3'
(R):5'- TCTGACCTGATGTGTGAAGATG -3'

Sequencing Primer
(F):5'- TCTGATGGCAGAGGAACACCC -3'
(R):5'- ACCTGATGTGTGAAGATGATTTG -3'

Posted On

2014-10-30