Incidental Mutation 'R2313:Cln5'
ID245386
Institutional Source Beutler Lab
Gene Symbol Cln5
Ensembl Gene ENSMUSG00000022125
Gene Nameceroid-lipofuscinosis, neuronal 5
SynonymsA730075N08Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R2313 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location103070216-103077628 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 103071746 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 79 (R79*)
Ref Sequence ENSEMBL: ENSMUSP00000022721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022721]
Predicted Effect probably null
Transcript: ENSMUST00000022721
AA Change: R79*
SMART Domains Protein: ENSMUSP00000022721
Gene: ENSMUSG00000022125
AA Change: R79*

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:CLN5 34 332 9e-169 PFAM
Predicted Effect silent
Transcript: ENSMUST00000227117
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of eight which have been associated with neuronal ceroid lipofuscinoses (NCL). Also referred to as Batten disease, NCL comprises a class of autosomal recessive, neurodegenerative disorders affecting children. The genes responsible likely encode proteins involved in the degradation of post-translationally modified proteins in lysosomes. The primary defect in NCL disorders is thought to be associated with lysosomal storage function.[provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutants showed loss of vision and accumulation of autofluorescent storage material in the central nervous system. Loss of a subset of GABAergic interneurons was seen in several brain areas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 T A 6: 116,413,861 D443V probably benign Het
Ankrd53 A T 6: 83,763,680 H95L probably damaging Het
Chrnb3 A G 8: 27,393,781 Y182C probably damaging Het
Cntn3 C A 6: 102,203,928 V769L probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Il1r1 T C 1: 40,313,310 S550P probably benign Het
Klra7 T A 6: 130,228,542 T132S probably benign Het
Lrch3 A G 16: 32,961,675 N273S probably damaging Het
Lrriq3 A T 3: 155,164,023 R328S probably benign Het
Mpp2 T C 11: 102,062,072 E318G possibly damaging Het
Olfr1228 C A 2: 89,248,941 C239F probably damaging Het
Olfr732 G A 14: 50,281,974 S93F probably damaging Het
Pglyrp2 A T 17: 32,418,699 D118E probably damaging Het
Ppp4c A G 7: 126,787,457 S153P probably damaging Het
Ptpn13 A G 5: 103,564,161 S1642G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Unc13d A G 11: 116,063,734 F1016S probably damaging Het
Vwa8 C G 14: 78,912,218 T140S probably damaging Het
Wdfy3 A G 5: 101,889,284 F2046L probably damaging Het
Zfp788 A G 7: 41,648,888 H316R probably damaging Het
Zfp994 T A 17: 22,201,285 I228F probably damaging Het
Other mutations in Cln5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Cln5 APN 14 103076032 missense possibly damaging 0.64
IGL02218:Cln5 APN 14 103075840 unclassified probably null
PIT4480001:Cln5 UTSW 14 103071778 nonsense probably null
R0649:Cln5 UTSW 14 103071761 missense probably benign
R2043:Cln5 UTSW 14 103075944 missense probably damaging 1.00
R3829:Cln5 UTSW 14 103073359 missense probably damaging 0.97
R5486:Cln5 UTSW 14 103076194 missense probably damaging 0.98
R6265:Cln5 UTSW 14 103073227 missense probably damaging 1.00
R6361:Cln5 UTSW 14 103076201 missense probably benign 0.05
R7361:Cln5 UTSW 14 103075903 missense probably damaging 1.00
R7869:Cln5 UTSW 14 103076065 missense probably damaging 1.00
R7952:Cln5 UTSW 14 103076065 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGTTTTGTCCCCGTGTTAAG -3'
(R):5'- TGACTCCCAACATAAAGGTGC -3'

Sequencing Primer
(F):5'- CCCCGTGTTAAGATTGTTAGAAGAGC -3'
(R):5'- CAGCCACTTGATGCTTGTGAACAG -3'
Posted On2014-10-30