Incidental Mutation 'R2313:Pglyrp2'
ID245389
Institutional Source Beutler Lab
Gene Symbol Pglyrp2
Ensembl Gene ENSMUSG00000079563
Gene Namepeptidoglycan recognition protein 2
SynonymstagL-alpha, PGRP-L, tagl-beta, tagL, C730002N09Rik, Pglyrpl
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2313 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location32413100-32424167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32418699 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 118 (D118E)
Ref Sequence ENSEMBL: ENSMUSP00000129964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114455] [ENSMUST00000170392]
Predicted Effect probably damaging
Transcript: ENSMUST00000114455
AA Change: D118E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110099
Gene: ENSMUSG00000079563
AA Change: D118E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 251 266 N/A INTRINSIC
low complexity region 270 281 N/A INTRINSIC
PGRP 360 506 6.61e-78 SMART
Ami_2 373 512 6.28e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170392
AA Change: D118E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129964
Gene: ENSMUSG00000079563
AA Change: D118E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 251 266 N/A INTRINSIC
low complexity region 270 281 N/A INTRINSIC
PGRP 360 506 6.61e-78 SMART
Ami_2 373 512 6.28e-10 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a peptidoglycan recognition protein, which belongs to the N-acetylmuramoyl-L-alanine amidase 2 family. This protein hydrolyzes the link between N-acetylmuramoyl residues and L-amino acid residues in bacterial cell wall glycopeptides, and thus may play a scavenger role by digesting biologically active peptidoglycan into biologically inactive fragments. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for disruption of this gene are viable and fertile with no gross developmental defects. Mice homozygous for a different knock-out allele are resistant to peptidoglycan- or muramyl dipeptide-induced arthritis and increased susceptibility to DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 T A 6: 116,413,861 D443V probably benign Het
Ankrd53 A T 6: 83,763,680 H95L probably damaging Het
Chrnb3 A G 8: 27,393,781 Y182C probably damaging Het
Cln5 C T 14: 103,071,746 R79* probably null Het
Cntn3 C A 6: 102,203,928 V769L probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Il1r1 T C 1: 40,313,310 S550P probably benign Het
Klra7 T A 6: 130,228,542 T132S probably benign Het
Lrch3 A G 16: 32,961,675 N273S probably damaging Het
Lrriq3 A T 3: 155,164,023 R328S probably benign Het
Mpp2 T C 11: 102,062,072 E318G possibly damaging Het
Olfr1228 C A 2: 89,248,941 C239F probably damaging Het
Olfr732 G A 14: 50,281,974 S93F probably damaging Het
Ppp4c A G 7: 126,787,457 S153P probably damaging Het
Ptpn13 A G 5: 103,564,161 S1642G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Unc13d A G 11: 116,063,734 F1016S probably damaging Het
Vwa8 C G 14: 78,912,218 T140S probably damaging Het
Wdfy3 A G 5: 101,889,284 F2046L probably damaging Het
Zfp788 A G 7: 41,648,888 H316R probably damaging Het
Zfp994 T A 17: 22,201,285 I228F probably damaging Het
Other mutations in Pglyrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:Pglyrp2 APN 17 32418577 missense probably benign 0.14
IGL01949:Pglyrp2 APN 17 32416106 splice site probably null
IGL02355:Pglyrp2 APN 17 32417022 missense probably damaging 1.00
IGL02362:Pglyrp2 APN 17 32417022 missense probably damaging 1.00
IGL02601:Pglyrp2 APN 17 32415861 missense probably benign 0.04
IGL02965:Pglyrp2 APN 17 32418586 missense probably benign 0.00
R0324:Pglyrp2 UTSW 17 32418328 missense probably benign 0.00
R0386:Pglyrp2 UTSW 17 32420862 start codon destroyed probably null 0.93
R2158:Pglyrp2 UTSW 17 32418248 missense probably benign 0.12
R2181:Pglyrp2 UTSW 17 32418962 missense probably damaging 1.00
R2191:Pglyrp2 UTSW 17 32415957 missense probably benign 0.04
R4825:Pglyrp2 UTSW 17 32418261 missense probably benign 0.00
R4852:Pglyrp2 UTSW 17 32415849 missense probably benign 0.09
R4888:Pglyrp2 UTSW 17 32418797 missense probably benign 0.26
R6941:Pglyrp2 UTSW 17 32416074 missense probably damaging 1.00
R7014:Pglyrp2 UTSW 17 32415930 missense probably damaging 0.98
R7327:Pglyrp2 UTSW 17 32415919 missense probably benign 0.16
R7886:Pglyrp2 UTSW 17 32418761 missense possibly damaging 0.53
R7969:Pglyrp2 UTSW 17 32418761 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GGTAAAGTGGCTCCAACATCTG -3'
(R):5'- CCTCTGCATGGATTCTGTCAG -3'

Sequencing Primer
(F):5'- CAACATCTGGAGAAGAGGCATTTG -3'
(R):5'- TGGATTCTGTCAGCCAAGAACTC -3'
Posted On2014-10-30