Incidental Mutation 'R2314:Ufc1'
ID245394
Institutional Source Beutler Lab
Gene Symbol Ufc1
Ensembl Gene ENSMUSG00000062963
Gene Nameubiquitin-fold modifier conjugating enzyme 1
SynonymsESTM29, 1110021H02Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.734) question?
Stock #R2314 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location171288563-171295024 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 171289248 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 116 (C116S)
Ref Sequence ENSEMBL: ENSMUSP00000106933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065941] [ENSMUST00000080001] [ENSMUST00000111302] [ENSMUST00000111305] [ENSMUST00000111306] [ENSMUST00000144576] [ENSMUST00000149187]
Predicted Effect probably benign
Transcript: ENSMUST00000065941
SMART Domains Protein: ENSMUSP00000064002
Gene: ENSMUSG00000053483

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
Pfam:UCH 211 556 9.4e-66 PFAM
Pfam:UCH_1 212 538 9.6e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080001
AA Change: C116S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078914
Gene: ENSMUSG00000062963
AA Change: C116S

DomainStartEndE-ValueType
Pfam:UFC1 4 164 1.3e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111302
AA Change: C116S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106933
Gene: ENSMUSG00000062963
AA Change: C116S

DomainStartEndE-ValueType
Pfam:UFC1 6 160 1.3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111305
SMART Domains Protein: ENSMUSP00000106936
Gene: ENSMUSG00000053483

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
Pfam:UCH 211 556 9.4e-66 PFAM
Pfam:UCH_1 212 538 9.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111306
SMART Domains Protein: ENSMUSP00000106938
Gene: ENSMUSG00000053483

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
Pfam:UCH 211 559 4.1e-60 PFAM
Pfam:UCH_1 215 541 3.6e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138974
Predicted Effect probably benign
Transcript: ENSMUST00000144576
SMART Domains Protein: ENSMUSP00000137977
Gene: ENSMUSG00000062963

DomainStartEndE-ValueType
Pfam:UFC1 4 91 2e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147176
Predicted Effect probably benign
Transcript: ENSMUST00000149187
SMART Domains Protein: ENSMUSP00000120161
Gene: ENSMUSG00000053483

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
Pfam:UCH 211 438 1e-36 PFAM
Pfam:UCH_1 212 436 2.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152621
Predicted Effect probably benign
Transcript: ENSMUST00000174720
SMART Domains Protein: ENSMUSP00000133362
Gene: ENSMUSG00000053483

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 21 36 N/A INTRINSIC
low complexity region 40 57 N/A INTRINSIC
Pfam:UCH 77 162 4.6e-18 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UFC1 is an E2-like conjugating enzyme for ubiquitin-fold modifier-1 (UFM1; MIM 610553) (Komatsu et al., 2004 [PubMed 15071506]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,684,702 S466G probably benign Het
Aasdhppt A G 9: 4,309,322 S39P probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Anxa6 T A 11: 55,011,735 I58F probably damaging Het
Ccdc30 T A 4: 119,324,566 K582* probably null Het
Cebpz A G 17: 78,920,547 probably null Het
Clstn3 T A 6: 124,450,717 D473V probably benign Het
Cry1 A T 10: 85,133,311 C550S probably benign Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dolk G T 2: 30,285,485 L183M probably damaging Het
Dpys T C 15: 39,828,090 T279A possibly damaging Het
Drd4 T C 7: 141,293,941 Y140H probably damaging Het
Duox1 C A 2: 122,333,730 C890* probably null Het
Epha2 T A 4: 141,319,014 V508E probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fahd1 A T 17: 24,849,596 I169N probably damaging Het
Fgfr1 C T 8: 25,570,893 S527F probably damaging Het
Flywch1 A G 17: 23,763,026 V68A probably benign Het
Gm21834 A T 17: 57,742,215 V2E possibly damaging Het
Gm7853 A T 14: 36,089,664 noncoding transcript Het
Igf2r T A 17: 12,715,943 H713L probably benign Het
Iqgap3 T C 3: 88,116,031 V543A probably benign Het
Kcnq5 T A 1: 21,479,371 probably null Het
Lsm1 C T 8: 25,785,684 P5S possibly damaging Het
March1 T C 8: 66,121,790 M1T probably null Het
Myocd T C 11: 65,200,807 H103R probably damaging Het
Myom2 C T 8: 15,063,927 T25I probably damaging Het
Nck1 T C 9: 100,497,950 K83E probably damaging Het
Nid2 A G 14: 19,789,761 D806G probably benign Het
Olfr639 T A 7: 104,012,229 M158L probably benign Het
Onecut2 G T 18: 64,341,197 R254L probably damaging Het
Plxna1 A C 6: 89,324,316 L1534R probably damaging Het
Polb C A 8: 22,640,002 A185S possibly damaging Het
Pou3f3 T C 1: 42,698,491 V449A probably damaging Het
Pskh1 C T 8: 105,913,513 T275I probably damaging Het
Rab18 C A 18: 6,788,516 A161D probably damaging Het
Rrp8 T C 7: 105,734,804 R164G probably benign Het
Sacs T A 14: 61,207,759 I2418K probably benign Het
Scrn1 T C 6: 54,525,646 E136G probably benign Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Slitrk6 C T 14: 110,751,955 A107T probably damaging Het
Tktl2 T A 8: 66,513,143 F451Y probably damaging Het
Tnks1bp1 G A 2: 85,058,915 V529M probably benign Het
Trps1 T C 15: 50,661,346 K874E probably damaging Het
Ttll9 T A 2: 152,983,127 D75E probably benign Het
Ttn A G 2: 76,766,024 Y20182H probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zfp809 A G 9: 22,238,680 K158E possibly damaging Het
Zfp81 A G 17: 33,334,623 Y406H probably damaging Het
Other mutations in Ufc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02641:Ufc1 APN 1 171290191 missense probably damaging 1.00
R0452:Ufc1 UTSW 1 171289954 unclassified probably benign
R1226:Ufc1 UTSW 1 171289237 missense probably benign
R3821:Ufc1 UTSW 1 171289599 unclassified probably benign
R4642:Ufc1 UTSW 1 171289894 missense probably benign 0.27
R4855:Ufc1 UTSW 1 171294802 utr 5 prime probably benign
R5390:Ufc1 UTSW 1 171290173 missense probably damaging 1.00
R6382:Ufc1 UTSW 1 171294675 missense probably damaging 1.00
R6419:Ufc1 UTSW 1 171288956 missense probably damaging 1.00
R7905:Ufc1 UTSW 1 171289935 missense probably damaging 0.99
R8794:Ufc1 UTSW 1 171289522 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAGGACATGCCCAAGGAATGTC -3'
(R):5'- AGCCCAAGAGACAATGGTTTC -3'

Sequencing Primer
(F):5'- TGCCCAAGGAATGTCTAGTCTCAG -3'
(R):5'- TCCAGCTGCTCCAGAGTCTAG -3'
Posted On2014-10-30