Incidental Mutation 'R2314:Dolk'
ID245395
Institutional Source Beutler Lab
Gene Symbol Dolk
Ensembl Gene ENSMUSG00000075419
Gene Namedolichol kinase
SynonymsTmem15
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2314 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location30284231-30286334 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 30285485 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 183 (L183M)
Ref Sequence ENSEMBL: ENSMUSP00000097792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064447] [ENSMUST00000091132] [ENSMUST00000100219] [ENSMUST00000113634] [ENSMUST00000113643] [ENSMUST00000113645] [ENSMUST00000127689] [ENSMUST00000133877] [ENSMUST00000138254] [ENSMUST00000138666] [ENSMUST00000150695] [ENSMUST00000139454] [ENSMUST00000148969] [ENSMUST00000154647]
Predicted Effect probably benign
Transcript: ENSMUST00000064447
SMART Domains Protein: ENSMUSP00000065836
Gene: ENSMUSG00000052533

DomainStartEndE-ValueType
Pfam:Nup188 31 941 9.3e-213 PFAM
low complexity region 1020 1035 N/A INTRINSIC
low complexity region 1307 1320 N/A INTRINSIC
low complexity region 1330 1360 N/A INTRINSIC
low complexity region 1696 1709 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091132
SMART Domains Protein: ENSMUSP00000088663
Gene: ENSMUSG00000079484

DomainStartEndE-ValueType
Pfam:PhyH 32 279 2.7e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100219
AA Change: L183M

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097792
Gene: ENSMUSG00000075419
AA Change: L183M

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 108 130 N/A INTRINSIC
transmembrane domain 134 153 N/A INTRINSIC
transmembrane domain 165 187 N/A INTRINSIC
transmembrane domain 221 243 N/A INTRINSIC
transmembrane domain 252 274 N/A INTRINSIC
transmembrane domain 294 313 N/A INTRINSIC
transmembrane domain 333 350 N/A INTRINSIC
transmembrane domain 355 377 N/A INTRINSIC
transmembrane domain 398 418 N/A INTRINSIC
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 476 493 N/A INTRINSIC
low complexity region 522 532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113634
SMART Domains Protein: ENSMUSP00000109264
Gene: ENSMUSG00000052533

DomainStartEndE-ValueType
Pfam:Nup188 27 128 1.2e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113643
SMART Domains Protein: ENSMUSP00000109273
Gene: ENSMUSG00000079484

DomainStartEndE-ValueType
Pfam:PhyH 12 238 9e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113645
SMART Domains Protein: ENSMUSP00000109275
Gene: ENSMUSG00000079484

DomainStartEndE-ValueType
Pfam:PhyH 12 259 1.4e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127689
SMART Domains Protein: ENSMUSP00000119543
Gene: ENSMUSG00000079484

DomainStartEndE-ValueType
Pfam:PhyH 12 150 7.5e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133603
Predicted Effect probably benign
Transcript: ENSMUST00000133877
SMART Domains Protein: ENSMUSP00000117643
Gene: ENSMUSG00000079484

DomainStartEndE-ValueType
Pfam:PhyH 8 249 9.3e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138254
SMART Domains Protein: ENSMUSP00000116062
Gene: ENSMUSG00000079484

DomainStartEndE-ValueType
Pfam:PhyH 12 157 2.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138666
SMART Domains Protein: ENSMUSP00000122398
Gene: ENSMUSG00000052533

DomainStartEndE-ValueType
Pfam:Nup188 27 118 1.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156023
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154988
Predicted Effect probably benign
Transcript: ENSMUST00000143119
SMART Domains Protein: ENSMUSP00000125607
Gene: ENSMUSG00000098794

DomainStartEndE-ValueType
PDB:3OBZ|A 1 31 4e-9 PDB
Pfam:Nup188 47 126 2.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150695
SMART Domains Protein: ENSMUSP00000121995
Gene: ENSMUSG00000079484

DomainStartEndE-ValueType
Pfam:PhyH 12 107 1.1e-16 PFAM
Pfam:PhyH 104 212 7.2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139454
SMART Domains Protein: ENSMUSP00000139038
Gene: ENSMUSG00000099041

DomainStartEndE-ValueType
Pfam:DUF3733 1 65 3.3e-32 PFAM
Pfam:DUF3733 97 156 2e-22 PFAM
transmembrane domain 320 342 N/A INTRINSIC
low complexity region 445 455 N/A INTRINSIC
internal_repeat_1 461 526 7.6e-5 PROSPERO
low complexity region 540 558 N/A INTRINSIC
LRR 590 613 5.41e0 SMART
LRR 614 636 3.18e2 SMART
LRR 638 660 6.78e1 SMART
LRR_TYP 661 684 1.06e-4 SMART
LRR 685 706 1.15e1 SMART
LRR_TYP 707 730 1.92e-2 SMART
LRR 731 751 1.81e2 SMART
LRR 753 776 2.02e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148969
SMART Domains Protein: ENSMUSP00000121742
Gene: ENSMUSG00000052533

DomainStartEndE-ValueType
Pfam:Nup188 27 115 1.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147204
SMART Domains Protein: ENSMUSP00000122095
Gene: ENSMUSG00000079484

DomainStartEndE-ValueType
PDB:3OBZ|A 2 42 4e-18 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000154647
SMART Domains Protein: ENSMUSP00000121371
Gene: ENSMUSG00000079484

DomainStartEndE-ValueType
Pfam:PhyH 12 259 1.4e-73 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the CTP-mediated phosphorylation of dolichol, and is involved in the synthesis of Dol-P-Man, which is an essential glycosyl carrier lipid for C- and O-mannosylation, N- and O-linked glycosylation of proteins, and for the biosynthesis of glycosyl phosphatidylinositol anchors in endoplasmic reticulum. Mutations in this gene are associated with dolichol kinase deficiency.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozyogus for a targeted null mutation exhibit lethality. Heterozygous mice show decreased depressive-like responses, hyperalgesia, and altered sensitivity to novelty-induced stress/anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,684,702 S466G probably benign Het
Aasdhppt A G 9: 4,309,322 S39P probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Anxa6 T A 11: 55,011,735 I58F probably damaging Het
Ccdc30 T A 4: 119,324,566 K582* probably null Het
Cebpz A G 17: 78,920,547 probably null Het
Clstn3 T A 6: 124,450,717 D473V probably benign Het
Cry1 A T 10: 85,133,311 C550S probably benign Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dpys T C 15: 39,828,090 T279A possibly damaging Het
Drd4 T C 7: 141,293,941 Y140H probably damaging Het
Duox1 C A 2: 122,333,730 C890* probably null Het
Epha2 T A 4: 141,319,014 V508E probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fahd1 A T 17: 24,849,596 I169N probably damaging Het
Fgfr1 C T 8: 25,570,893 S527F probably damaging Het
Flywch1 A G 17: 23,763,026 V68A probably benign Het
Gm21834 A T 17: 57,742,215 V2E possibly damaging Het
Gm7853 A T 14: 36,089,664 noncoding transcript Het
Igf2r T A 17: 12,715,943 H713L probably benign Het
Iqgap3 T C 3: 88,116,031 V543A probably benign Het
Kcnq5 T A 1: 21,479,371 probably null Het
Lsm1 C T 8: 25,785,684 P5S possibly damaging Het
March1 T C 8: 66,121,790 M1T probably null Het
Myocd T C 11: 65,200,807 H103R probably damaging Het
Myom2 C T 8: 15,063,927 T25I probably damaging Het
Nck1 T C 9: 100,497,950 K83E probably damaging Het
Nid2 A G 14: 19,789,761 D806G probably benign Het
Olfr639 T A 7: 104,012,229 M158L probably benign Het
Onecut2 G T 18: 64,341,197 R254L probably damaging Het
Plxna1 A C 6: 89,324,316 L1534R probably damaging Het
Polb C A 8: 22,640,002 A185S possibly damaging Het
Pou3f3 T C 1: 42,698,491 V449A probably damaging Het
Pskh1 C T 8: 105,913,513 T275I probably damaging Het
Rab18 C A 18: 6,788,516 A161D probably damaging Het
Rrp8 T C 7: 105,734,804 R164G probably benign Het
Sacs T A 14: 61,207,759 I2418K probably benign Het
Scrn1 T C 6: 54,525,646 E136G probably benign Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Slitrk6 C T 14: 110,751,955 A107T probably damaging Het
Tktl2 T A 8: 66,513,143 F451Y probably damaging Het
Tnks1bp1 G A 2: 85,058,915 V529M probably benign Het
Trps1 T C 15: 50,661,346 K874E probably damaging Het
Ttll9 T A 2: 152,983,127 D75E probably benign Het
Ttn A G 2: 76,766,024 Y20182H probably damaging Het
Ufc1 A T 1: 171,289,248 C116S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zfp809 A G 9: 22,238,680 K158E possibly damaging Het
Zfp81 A G 17: 33,334,623 Y406H probably damaging Het
Other mutations in Dolk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Dolk APN 2 30284731 missense probably damaging 1.00
IGL01529:Dolk APN 2 30285737 missense probably benign
IGL01893:Dolk APN 2 30285914 missense probably benign 0.03
IGL02138:Dolk APN 2 30285979 missense probably benign 0.08
IGL02392:Dolk APN 2 30285728 missense probably benign 0.34
IGL03247:Dolk APN 2 30285511 missense probably damaging 1.00
PIT4131001:Dolk UTSW 2 30285574 missense probably benign 0.01
R0243:Dolk UTSW 2 30286019 missense probably benign
R1330:Dolk UTSW 2 30285100 missense probably damaging 1.00
R1564:Dolk UTSW 2 30285621 missense probably damaging 0.99
R4299:Dolk UTSW 2 30285188 missense probably damaging 1.00
R5526:Dolk UTSW 2 30285808 missense probably damaging 1.00
R7520:Dolk UTSW 2 30284543 missense probably benign
R7890:Dolk UTSW 2 30284714 missense probably damaging 1.00
R7896:Dolk UTSW 2 30285949 missense possibly damaging 0.58
R8849:Dolk UTSW 2 30284923 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGCCTGAATCCATGAAGAC -3'
(R):5'- TGGTTGCAGCTACTGGCATG -3'

Sequencing Primer
(F):5'- TGCCTGAATCCATGAAGACAAAGAG -3'
(R):5'- AGCTACTGGCATGGCAGTG -3'
Posted On2014-10-30