Incidental Mutation 'R2314:Ccdc30'
ID245404
Institutional Source Beutler Lab
Gene Symbol Ccdc30
Ensembl Gene ENSMUSG00000028637
Gene Namecoiled-coil domain containing 30
Synonyms4930445I03Rik, 1700041C02Rik, 1700001O02Rik, 1700111D19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2314 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location119322893-119415521 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 119324566 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 582 (K582*)
Ref Sequence ENSEMBL: ENSMUSP00000070621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056458] [ENSMUST00000063642] [ENSMUST00000106317] [ENSMUST00000106318] [ENSMUST00000106319] [ENSMUST00000106321] [ENSMUST00000147077]
Predicted Effect probably benign
Transcript: ENSMUST00000056458
SMART Domains Protein: ENSMUSP00000051221
Gene: ENSMUSG00000060288

DomainStartEndE-ValueType
Pfam:Pro_isomerase 14 176 5.8e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000063642
AA Change: K582*
SMART Domains Protein: ENSMUSP00000070621
Gene: ENSMUSG00000028637
AA Change: K582*

DomainStartEndE-ValueType
Pfam:DUF4686 170 547 5.1e-155 PFAM
low complexity region 555 568 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106317
SMART Domains Protein: ENSMUSP00000101924
Gene: ENSMUSG00000060288

DomainStartEndE-ValueType
Pfam:Pro_isomerase 14 170 2.4e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106318
SMART Domains Protein: ENSMUSP00000101925
Gene: ENSMUSG00000060288

DomainStartEndE-ValueType
Pfam:Pro_isomerase 14 176 5.8e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106319
SMART Domains Protein: ENSMUSP00000101926
Gene: ENSMUSG00000060288

DomainStartEndE-ValueType
Pfam:Pro_isomerase 14 132 8.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106321
SMART Domains Protein: ENSMUSP00000101928
Gene: ENSMUSG00000060288

DomainStartEndE-ValueType
Pfam:Pro_isomerase 14 176 5.8e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147077
SMART Domains Protein: ENSMUSP00000118407
Gene: ENSMUSG00000060288

DomainStartEndE-ValueType
Pfam:Pro_isomerase 2 157 2.9e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154606
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,684,702 S466G probably benign Het
Aasdhppt A G 9: 4,309,322 S39P probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Anxa6 T A 11: 55,011,735 I58F probably damaging Het
Cebpz A G 17: 78,920,547 probably null Het
Clstn3 T A 6: 124,450,717 D473V probably benign Het
Cry1 A T 10: 85,133,311 C550S probably benign Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dolk G T 2: 30,285,485 L183M probably damaging Het
Dpys T C 15: 39,828,090 T279A possibly damaging Het
Drd4 T C 7: 141,293,941 Y140H probably damaging Het
Duox1 C A 2: 122,333,730 C890* probably null Het
Epha2 T A 4: 141,319,014 V508E probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fahd1 A T 17: 24,849,596 I169N probably damaging Het
Fgfr1 C T 8: 25,570,893 S527F probably damaging Het
Flywch1 A G 17: 23,763,026 V68A probably benign Het
Gm21834 A T 17: 57,742,215 V2E possibly damaging Het
Gm7853 A T 14: 36,089,664 noncoding transcript Het
Igf2r T A 17: 12,715,943 H713L probably benign Het
Iqgap3 T C 3: 88,116,031 V543A probably benign Het
Kcnq5 T A 1: 21,479,371 probably null Het
Lsm1 C T 8: 25,785,684 P5S possibly damaging Het
March1 T C 8: 66,121,790 M1T probably null Het
Myocd T C 11: 65,200,807 H103R probably damaging Het
Myom2 C T 8: 15,063,927 T25I probably damaging Het
Nck1 T C 9: 100,497,950 K83E probably damaging Het
Nid2 A G 14: 19,789,761 D806G probably benign Het
Olfr639 T A 7: 104,012,229 M158L probably benign Het
Onecut2 G T 18: 64,341,197 R254L probably damaging Het
Plxna1 A C 6: 89,324,316 L1534R probably damaging Het
Polb C A 8: 22,640,002 A185S possibly damaging Het
Pou3f3 T C 1: 42,698,491 V449A probably damaging Het
Pskh1 C T 8: 105,913,513 T275I probably damaging Het
Rab18 C A 18: 6,788,516 A161D probably damaging Het
Rrp8 T C 7: 105,734,804 R164G probably benign Het
Sacs T A 14: 61,207,759 I2418K probably benign Het
Scrn1 T C 6: 54,525,646 E136G probably benign Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Slitrk6 C T 14: 110,751,955 A107T probably damaging Het
Tktl2 T A 8: 66,513,143 F451Y probably damaging Het
Tnks1bp1 G A 2: 85,058,915 V529M probably benign Het
Trps1 T C 15: 50,661,346 K874E probably damaging Het
Ttll9 T A 2: 152,983,127 D75E probably benign Het
Ttn A G 2: 76,766,024 Y20182H probably damaging Het
Ufc1 A T 1: 171,289,248 C116S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zfp809 A G 9: 22,238,680 K158E possibly damaging Het
Zfp81 A G 17: 33,334,623 Y406H probably damaging Het
Other mutations in Ccdc30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Ccdc30 APN 4 119393579 missense possibly damaging 0.93
IGL01546:Ccdc30 APN 4 119398188 missense probably damaging 0.99
IGL01691:Ccdc30 APN 4 119393564 missense probably damaging 0.96
IGL02178:Ccdc30 APN 4 119349724 unclassified probably benign
IGL02341:Ccdc30 APN 4 119356781 missense possibly damaging 0.83
IGL03063:Ccdc30 APN 4 119349767 missense possibly damaging 0.68
IGL03394:Ccdc30 APN 4 119359582 missense probably damaging 1.00
G1patch:Ccdc30 UTSW 4 119331599 missense probably damaging 1.00
R1587:Ccdc30 UTSW 4 119353176 missense probably damaging 1.00
R1604:Ccdc30 UTSW 4 119331596 missense probably damaging 0.99
R1842:Ccdc30 UTSW 4 119331127 missense probably benign
R1962:Ccdc30 UTSW 4 119339791 missense probably benign 0.00
R2157:Ccdc30 UTSW 4 119333724 splice site probably benign
R2362:Ccdc30 UTSW 4 119324056 missense probably damaging 0.99
R3407:Ccdc30 UTSW 4 119324581 missense possibly damaging 0.63
R3755:Ccdc30 UTSW 4 119367808 critical splice donor site probably null
R3938:Ccdc30 UTSW 4 119352673 missense probably benign 0.02
R4762:Ccdc30 UTSW 4 119333588 missense probably damaging 0.98
R5014:Ccdc30 UTSW 4 119393627 missense possibly damaging 0.96
R5635:Ccdc30 UTSW 4 119359674 missense possibly damaging 0.66
R6282:Ccdc30 UTSW 4 119324017 missense probably damaging 0.98
R6382:Ccdc30 UTSW 4 119404166 missense possibly damaging 0.93
R6725:Ccdc30 UTSW 4 119331599 missense probably damaging 1.00
R6746:Ccdc30 UTSW 4 119356718 missense probably benign 0.03
R7230:Ccdc30 UTSW 4 119339782 missense possibly damaging 0.89
R7576:Ccdc30 UTSW 4 119349866 missense probably damaging 1.00
R7673:Ccdc30 UTSW 4 119353172 missense probably damaging 1.00
R7719:Ccdc30 UTSW 4 119333616 missense probably damaging 1.00
R7895:Ccdc30 UTSW 4 119352713 splice site probably null
R8021:Ccdc30 UTSW 4 119352679 missense probably benign 0.00
R8113:Ccdc30 UTSW 4 119373746 missense probably benign 0.32
R8696:Ccdc30 UTSW 4 119377308 missense possibly damaging 0.92
R8713:Ccdc30 UTSW 4 119404207 missense probably damaging 0.99
R8885:Ccdc30 UTSW 4 119324562 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCGTGGATTATCCCCTACCTGAG -3'
(R):5'- AGAAGCCTGTCCCAAGATGG -3'

Sequencing Primer
(F):5'- GGATTATCCCCTACCTGAGATTGG -3'
(R):5'- GAGTAGGTTTGGCCTCTCAACAG -3'
Posted On2014-10-30