Incidental Mutation 'R2314:Clstn3'
ID 245408
Institutional Source Beutler Lab
Gene Symbol Clstn3
Ensembl Gene ENSMUSG00000008153
Gene Name calsyntenin 3
Synonyms Cst-3, CSTN3, alcadein-beta
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2314 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 124407715-124441743 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 124427676 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 473 (D473V)
Ref Sequence ENSEMBL: ENSMUSP00000108142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008297] [ENSMUST00000112523]
AlphaFold Q99JH7
Predicted Effect probably benign
Transcript: ENSMUST00000008297
AA Change: D510V

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000008297
Gene: ENSMUSG00000008153
AA Change: D510V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CA 50 143 2.72e-12 SMART
CA 166 244 4.04e-2 SMART
SCOP:d1a8d_1 333 549 7e-23 SMART
transmembrane domain 846 868 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112523
AA Change: D473V

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108142
Gene: ENSMUSG00000008153
AA Change: D473V

DomainStartEndE-ValueType
CA 13 106 2.72e-12 SMART
CA 129 207 4.04e-2 SMART
Pfam:Laminin_G_3 304 505 4.1e-8 PFAM
transmembrane domain 809 831 N/A INTRINSIC
low complexity region 891 908 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147947
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reductions in excitatory and inhibitory synapse density and deficits in synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A G 9: 4,309,322 (GRCm39) S39P probably damaging Het
Aif1 G A 17: 35,391,127 (GRCm39) P44L probably benign Het
Anxa6 T A 11: 54,902,561 (GRCm39) I58F probably damaging Het
Ccdc30 T A 4: 119,181,763 (GRCm39) K582* probably null Het
Cebpz A G 17: 79,227,976 (GRCm39) probably null Het
Cry1 A T 10: 84,969,175 (GRCm39) C550S probably benign Het
Dclk2 G A 3: 86,827,342 (GRCm39) P46S probably damaging Het
Dolk G T 2: 30,175,497 (GRCm39) L183M probably damaging Het
Dpys T C 15: 39,691,486 (GRCm39) T279A possibly damaging Het
Drd4 T C 7: 140,873,854 (GRCm39) Y140H probably damaging Het
Duox1 C A 2: 122,164,211 (GRCm39) C890* probably null Het
Epha2 T A 4: 141,046,325 (GRCm39) V508E probably damaging Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Fahd1 A T 17: 25,068,570 (GRCm39) I169N probably damaging Het
Fgfr1 C T 8: 26,060,909 (GRCm39) S527F probably damaging Het
Flywch1 A G 17: 23,982,000 (GRCm39) V68A probably benign Het
Gm21834 A T 17: 58,049,210 (GRCm39) V2E possibly damaging Het
Gm7853 A T 14: 35,811,621 (GRCm39) noncoding transcript Het
Igf2r T A 17: 12,934,830 (GRCm39) H713L probably benign Het
Iqgap3 T C 3: 88,023,338 (GRCm39) V543A probably benign Het
Kcnq5 T A 1: 21,549,595 (GRCm39) probably null Het
Lsm1 C T 8: 26,275,712 (GRCm39) P5S possibly damaging Het
Marchf1 T C 8: 66,574,442 (GRCm39) M1T probably null Het
Myocd T C 11: 65,091,633 (GRCm39) H103R probably damaging Het
Myom2 C T 8: 15,113,927 (GRCm39) T25I probably damaging Het
Nck1 T C 9: 100,380,003 (GRCm39) K83E probably damaging Het
Nid2 A G 14: 19,839,829 (GRCm39) D806G probably benign Het
Onecut2 G T 18: 64,474,268 (GRCm39) R254L probably damaging Het
Or51k1 T A 7: 103,661,436 (GRCm39) M158L probably benign Het
Plxna1 A C 6: 89,301,298 (GRCm39) L1534R probably damaging Het
Polb C A 8: 23,130,018 (GRCm39) A185S possibly damaging Het
Pou3f3 T C 1: 42,737,651 (GRCm39) V449A probably damaging Het
Pskh1 C T 8: 106,640,145 (GRCm39) T275I probably damaging Het
Rab18 C A 18: 6,788,516 (GRCm39) A161D probably damaging Het
Rrp8 T C 7: 105,384,011 (GRCm39) R164G probably benign Het
Sacs T A 14: 61,445,208 (GRCm39) I2418K probably benign Het
Scrn1 T C 6: 54,502,631 (GRCm39) E136G probably benign Het
Sgk1 C T 10: 21,872,500 (GRCm39) R171W probably damaging Het
Slitrk6 C T 14: 110,989,387 (GRCm39) A107T probably damaging Het
Spata31e2 T C 1: 26,723,783 (GRCm39) S466G probably benign Het
Tktl2 T A 8: 66,965,795 (GRCm39) F451Y probably damaging Het
Tnks1bp1 G A 2: 84,889,259 (GRCm39) V529M probably benign Het
Trps1 T C 15: 50,524,742 (GRCm39) K874E probably damaging Het
Ttll9 T A 2: 152,825,047 (GRCm39) D75E probably benign Het
Ttn A G 2: 76,596,368 (GRCm39) Y20182H probably damaging Het
Ufc1 A T 1: 171,116,821 (GRCm39) C116S probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Zfp809 A G 9: 22,149,976 (GRCm39) K158E possibly damaging Het
Zfp81 A G 17: 33,553,597 (GRCm39) Y406H probably damaging Het
Other mutations in Clstn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Clstn3 APN 6 124,439,098 (GRCm39) missense probably damaging 1.00
IGL01415:Clstn3 APN 6 124,415,781 (GRCm39) nonsense probably null
IGL01521:Clstn3 APN 6 124,434,990 (GRCm39) nonsense probably null
IGL01537:Clstn3 APN 6 124,408,559 (GRCm39) missense possibly damaging 0.91
IGL01729:Clstn3 APN 6 124,426,753 (GRCm39) missense probably benign 0.06
IGL01879:Clstn3 APN 6 124,415,769 (GRCm39) missense probably damaging 1.00
IGL01998:Clstn3 APN 6 124,435,622 (GRCm39) missense probably damaging 1.00
IGL03130:Clstn3 APN 6 124,436,222 (GRCm39) missense probably damaging 0.98
IGL03405:Clstn3 APN 6 124,415,327 (GRCm39) missense possibly damaging 0.95
PIT4403001:Clstn3 UTSW 6 124,434,982 (GRCm39) missense probably damaging 1.00
R0049:Clstn3 UTSW 6 124,436,812 (GRCm39) missense possibly damaging 0.87
R0049:Clstn3 UTSW 6 124,436,812 (GRCm39) missense possibly damaging 0.87
R0208:Clstn3 UTSW 6 124,409,128 (GRCm39) splice site probably benign
R0276:Clstn3 UTSW 6 124,408,699 (GRCm39) splice site probably benign
R0440:Clstn3 UTSW 6 124,428,372 (GRCm39) missense probably damaging 1.00
R0612:Clstn3 UTSW 6 124,426,459 (GRCm39) missense probably damaging 0.98
R1200:Clstn3 UTSW 6 124,436,129 (GRCm39) missense probably damaging 1.00
R1224:Clstn3 UTSW 6 124,434,878 (GRCm39) missense probably benign
R1378:Clstn3 UTSW 6 124,415,378 (GRCm39) missense probably damaging 1.00
R1491:Clstn3 UTSW 6 124,414,449 (GRCm39) missense possibly damaging 0.51
R1495:Clstn3 UTSW 6 124,426,876 (GRCm39) missense probably benign 0.00
R1511:Clstn3 UTSW 6 124,439,128 (GRCm39) missense probably damaging 1.00
R1655:Clstn3 UTSW 6 124,414,386 (GRCm39) missense probably damaging 1.00
R1731:Clstn3 UTSW 6 124,408,591 (GRCm39) missense probably benign 0.04
R1734:Clstn3 UTSW 6 124,413,773 (GRCm39) splice site probably benign
R1751:Clstn3 UTSW 6 124,408,958 (GRCm39) missense probably damaging 1.00
R1954:Clstn3 UTSW 6 124,436,257 (GRCm39) missense possibly damaging 0.94
R2133:Clstn3 UTSW 6 124,426,462 (GRCm39) missense probably benign
R2192:Clstn3 UTSW 6 124,436,166 (GRCm39) missense probably damaging 1.00
R2874:Clstn3 UTSW 6 124,415,294 (GRCm39) missense probably damaging 1.00
R3500:Clstn3 UTSW 6 124,408,670 (GRCm39) missense probably benign 0.01
R3761:Clstn3 UTSW 6 124,434,835 (GRCm39) missense possibly damaging 0.54
R3878:Clstn3 UTSW 6 124,434,901 (GRCm39) missense probably damaging 0.97
R3927:Clstn3 UTSW 6 124,428,327 (GRCm39) missense probably damaging 1.00
R3934:Clstn3 UTSW 6 124,434,901 (GRCm39) missense probably damaging 0.97
R3935:Clstn3 UTSW 6 124,434,901 (GRCm39) missense probably damaging 0.97
R4063:Clstn3 UTSW 6 124,426,792 (GRCm39) missense possibly damaging 0.51
R4402:Clstn3 UTSW 6 124,433,939 (GRCm39) missense probably damaging 0.96
R4534:Clstn3 UTSW 6 124,436,179 (GRCm39) missense probably damaging 1.00
R4785:Clstn3 UTSW 6 124,414,331 (GRCm39) splice site probably null
R4834:Clstn3 UTSW 6 124,408,912 (GRCm39) splice site probably null
R5921:Clstn3 UTSW 6 124,408,539 (GRCm39) utr 3 prime probably benign
R5932:Clstn3 UTSW 6 124,415,291 (GRCm39) missense probably benign 0.01
R6025:Clstn3 UTSW 6 124,408,623 (GRCm39) missense possibly damaging 0.73
R6101:Clstn3 UTSW 6 124,438,629 (GRCm39) missense probably damaging 1.00
R6360:Clstn3 UTSW 6 124,415,388 (GRCm39) missense possibly damaging 0.88
R6578:Clstn3 UTSW 6 124,427,663 (GRCm39) critical splice donor site probably null
R6813:Clstn3 UTSW 6 124,413,894 (GRCm39) missense probably benign 0.00
R7380:Clstn3 UTSW 6 124,433,948 (GRCm39) missense probably benign 0.01
R7419:Clstn3 UTSW 6 124,435,088 (GRCm39) missense probably benign 0.05
R7625:Clstn3 UTSW 6 124,414,377 (GRCm39) nonsense probably null
R7780:Clstn3 UTSW 6 124,439,161 (GRCm39) missense probably damaging 0.98
R7936:Clstn3 UTSW 6 124,408,972 (GRCm39) missense possibly damaging 0.73
R7939:Clstn3 UTSW 6 124,439,158 (GRCm39) missense probably damaging 1.00
R8047:Clstn3 UTSW 6 124,408,972 (GRCm39) missense possibly damaging 0.73
R8079:Clstn3 UTSW 6 124,436,763 (GRCm39) missense probably damaging 1.00
R8085:Clstn3 UTSW 6 124,435,683 (GRCm39) missense probably benign 0.23
R8299:Clstn3 UTSW 6 124,414,332 (GRCm39) critical splice donor site probably null
R8406:Clstn3 UTSW 6 124,439,136 (GRCm39) missense probably damaging 1.00
R8685:Clstn3 UTSW 6 124,433,867 (GRCm39) missense probably damaging 1.00
R9045:Clstn3 UTSW 6 124,408,921 (GRCm39) missense probably damaging 0.98
R9209:Clstn3 UTSW 6 124,408,571 (GRCm39) missense probably benign 0.02
R9264:Clstn3 UTSW 6 124,436,727 (GRCm39) missense probably damaging 1.00
R9268:Clstn3 UTSW 6 124,433,880 (GRCm39) missense probably damaging 0.99
R9443:Clstn3 UTSW 6 124,428,358 (GRCm39) missense probably damaging 1.00
RF014:Clstn3 UTSW 6 124,436,225 (GRCm39) nonsense probably null
X0066:Clstn3 UTSW 6 124,426,770 (GRCm39) missense probably benign 0.13
Z1176:Clstn3 UTSW 6 124,436,159 (GRCm39) missense probably damaging 1.00
Z1177:Clstn3 UTSW 6 124,426,740 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCTTGCTCCAAGGAGAACC -3'
(R):5'- CATTTGCGTACCAGAGTCCTC -3'

Sequencing Primer
(F):5'- AGAACCTGCCTTGGCTTAGAGAC -3'
(R):5'- CTATAACATAGGCCTGCAAGATTGG -3'
Posted On 2014-10-30