Incidental Mutation 'R2314:Drd4'
ID245411
Institutional Source Beutler Lab
Gene Symbol Drd4
Ensembl Gene ENSMUSG00000025496
Gene Namedopamine receptor D4
SynonymsD4R, Drd-4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R2314 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location141292006-141296464 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141293941 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 140 (Y140H)
Ref Sequence ENSEMBL: ENSMUSP00000026569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026569] [ENSMUST00000080553] [ENSMUST00000211146]
Predicted Effect probably damaging
Transcript: ENSMUST00000026569
AA Change: Y140H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026569
Gene: ENSMUSG00000025496
AA Change: Y140H

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 40 182 9.6e-9 PFAM
Pfam:7tm_1 48 368 1.8e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080553
SMART Domains Protein: ENSMUSP00000079395
Gene: ENSMUSG00000058886

DomainStartEndE-ValueType
SCOP:d1gkub1 6 35 9e-3 SMART
low complexity region 43 68 N/A INTRINSIC
low complexity region 88 105 N/A INTRINSIC
low complexity region 167 186 N/A INTRINSIC
SAND 202 274 9.78e-40 SMART
low complexity region 277 286 N/A INTRINSIC
low complexity region 324 338 N/A INTRINSIC
Pfam:zf-MYND 505 541 8.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209600
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209649
Predicted Effect probably benign
Transcript: ENSMUST00000210062
Predicted Effect probably benign
Transcript: ENSMUST00000211146
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the D4 subtype of the dopamine receptor. The D4 subtype is a G-protein coupled receptor which inhibits adenylyl cyclase. It is a target for drugs which treat schizophrenia and Parkinson disease. Mutations in this gene have been associated with various behavioral phenotypes, including autonomic nervous system dysfunction, attention deficit/hyperactivity disorder, and the personality trait of novelty seeking. This gene contains a polymorphic number (2-10 copies) of tandem 48 nt repeats; the sequence shown contains four repeats. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants are less active in open field tests and have reduced responses to novelty. However, mice exhibit locomotor supersensitivity to ethanol, cocaine, and methamphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,684,702 S466G probably benign Het
Aasdhppt A G 9: 4,309,322 S39P probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Anxa6 T A 11: 55,011,735 I58F probably damaging Het
Ccdc30 T A 4: 119,324,566 K582* probably null Het
Cebpz A G 17: 78,920,547 probably null Het
Clstn3 T A 6: 124,450,717 D473V probably benign Het
Cry1 A T 10: 85,133,311 C550S probably benign Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dolk G T 2: 30,285,485 L183M probably damaging Het
Dpys T C 15: 39,828,090 T279A possibly damaging Het
Duox1 C A 2: 122,333,730 C890* probably null Het
Epha2 T A 4: 141,319,014 V508E probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fahd1 A T 17: 24,849,596 I169N probably damaging Het
Fgfr1 C T 8: 25,570,893 S527F probably damaging Het
Flywch1 A G 17: 23,763,026 V68A probably benign Het
Gm21834 A T 17: 57,742,215 V2E possibly damaging Het
Gm7853 A T 14: 36,089,664 noncoding transcript Het
Igf2r T A 17: 12,715,943 H713L probably benign Het
Iqgap3 T C 3: 88,116,031 V543A probably benign Het
Kcnq5 T A 1: 21,479,371 probably null Het
Lsm1 C T 8: 25,785,684 P5S possibly damaging Het
March1 T C 8: 66,121,790 M1T probably null Het
Myocd T C 11: 65,200,807 H103R probably damaging Het
Myom2 C T 8: 15,063,927 T25I probably damaging Het
Nck1 T C 9: 100,497,950 K83E probably damaging Het
Nid2 A G 14: 19,789,761 D806G probably benign Het
Olfr639 T A 7: 104,012,229 M158L probably benign Het
Onecut2 G T 18: 64,341,197 R254L probably damaging Het
Plxna1 A C 6: 89,324,316 L1534R probably damaging Het
Polb C A 8: 22,640,002 A185S possibly damaging Het
Pou3f3 T C 1: 42,698,491 V449A probably damaging Het
Pskh1 C T 8: 105,913,513 T275I probably damaging Het
Rab18 C A 18: 6,788,516 A161D probably damaging Het
Rrp8 T C 7: 105,734,804 R164G probably benign Het
Sacs T A 14: 61,207,759 I2418K probably benign Het
Scrn1 T C 6: 54,525,646 E136G probably benign Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Slitrk6 C T 14: 110,751,955 A107T probably damaging Het
Tktl2 T A 8: 66,513,143 F451Y probably damaging Het
Tnks1bp1 G A 2: 85,058,915 V529M probably benign Het
Trps1 T C 15: 50,661,346 K874E probably damaging Het
Ttll9 T A 2: 152,983,127 D75E probably benign Het
Ttn A G 2: 76,766,024 Y20182H probably damaging Het
Ufc1 A T 1: 171,289,248 C116S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zfp809 A G 9: 22,238,680 K158E possibly damaging Het
Zfp81 A G 17: 33,334,623 Y406H probably damaging Het
Other mutations in Drd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Drd4 APN 7 141292183 missense probably damaging 1.00
IGL01542:Drd4 APN 7 141293831 unclassified probably benign
R2484:Drd4 UTSW 7 141294736 missense probably benign
R3054:Drd4 UTSW 7 141294479 missense probably damaging 0.99
R3055:Drd4 UTSW 7 141294479 missense probably damaging 0.99
R3108:Drd4 UTSW 7 141292282 missense possibly damaging 0.95
R3109:Drd4 UTSW 7 141292282 missense possibly damaging 0.95
R4597:Drd4 UTSW 7 141294479 missense probably damaging 0.99
R4964:Drd4 UTSW 7 141293777 missense probably damaging 1.00
R4966:Drd4 UTSW 7 141293777 missense probably damaging 1.00
R5474:Drd4 UTSW 7 141293728 missense probably damaging 1.00
R6010:Drd4 UTSW 7 141294796 missense probably damaging 1.00
R6480:Drd4 UTSW 7 141294793 missense possibly damaging 0.71
R7206:Drd4 UTSW 7 141292119 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTCTGTGACACGCTCATG -3'
(R):5'- CCCAGTAAAGCAGTAGCATGAGC -3'

Sequencing Primer
(F):5'- TGACACGCTCATGGCCATG -3'
(R):5'- GCATGAGCGGACAGGGC -3'
Posted On2014-10-30