Incidental Mutation 'R2314:Myom2'
ID245412
Institutional Source Beutler Lab
Gene Symbol Myom2
Ensembl Gene ENSMUSG00000031461
Gene Namemyomesin 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R2314 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location15057653-15133541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 15063927 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 25 (T25I)
Ref Sequence ENSEMBL: ENSMUSP00000033842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033842]
Predicted Effect probably damaging
Transcript: ENSMUST00000033842
AA Change: T25I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033842
Gene: ENSMUSG00000031461
AA Change: T25I

DomainStartEndE-ValueType
low complexity region 34 63 N/A INTRINSIC
low complexity region 79 87 N/A INTRINSIC
coiled coil region 97 129 N/A INTRINSIC
IG 160 247 7.7e-5 SMART
IG 284 373 8.01e-3 SMART
FN3 383 466 1.5e-14 SMART
FN3 511 594 1.79e-12 SMART
FN3 612 693 1.95e-13 SMART
FN3 711 794 8.69e-11 SMART
FN3 813 896 1.86e-10 SMART
IG_like 913 999 1.58e2 SMART
Blast:IG_like 1021 1106 1e-44 BLAST
IG_like 1135 1215 2.27e1 SMART
Blast:IG_like 1227 1321 9e-51 BLAST
IGc2 1357 1425 4.96e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135908
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD and 165 kD. The predicted MYOM2 protein contains 1,465 amino acids. Like MYOM1, MYOM2 has a unique N-terminal domain followed by 12 repeat domains with strong homology to either fibronectin type III or immunoglobulin C2 domains. Protein sequence comparisons suggested that the MYOM2 protein and bovine M protein are identical. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,684,702 S466G probably benign Het
Aasdhppt A G 9: 4,309,322 S39P probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Anxa6 T A 11: 55,011,735 I58F probably damaging Het
Ccdc30 T A 4: 119,324,566 K582* probably null Het
Cebpz A G 17: 78,920,547 probably null Het
Clstn3 T A 6: 124,450,717 D473V probably benign Het
Cry1 A T 10: 85,133,311 C550S probably benign Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dolk G T 2: 30,285,485 L183M probably damaging Het
Dpys T C 15: 39,828,090 T279A possibly damaging Het
Drd4 T C 7: 141,293,941 Y140H probably damaging Het
Duox1 C A 2: 122,333,730 C890* probably null Het
Epha2 T A 4: 141,319,014 V508E probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fahd1 A T 17: 24,849,596 I169N probably damaging Het
Fgfr1 C T 8: 25,570,893 S527F probably damaging Het
Flywch1 A G 17: 23,763,026 V68A probably benign Het
Gm21834 A T 17: 57,742,215 V2E possibly damaging Het
Gm7853 A T 14: 36,089,664 noncoding transcript Het
Igf2r T A 17: 12,715,943 H713L probably benign Het
Iqgap3 T C 3: 88,116,031 V543A probably benign Het
Kcnq5 T A 1: 21,479,371 probably null Het
Lsm1 C T 8: 25,785,684 P5S possibly damaging Het
March1 T C 8: 66,121,790 M1T probably null Het
Myocd T C 11: 65,200,807 H103R probably damaging Het
Nck1 T C 9: 100,497,950 K83E probably damaging Het
Nid2 A G 14: 19,789,761 D806G probably benign Het
Olfr639 T A 7: 104,012,229 M158L probably benign Het
Onecut2 G T 18: 64,341,197 R254L probably damaging Het
Plxna1 A C 6: 89,324,316 L1534R probably damaging Het
Polb C A 8: 22,640,002 A185S possibly damaging Het
Pou3f3 T C 1: 42,698,491 V449A probably damaging Het
Pskh1 C T 8: 105,913,513 T275I probably damaging Het
Rab18 C A 18: 6,788,516 A161D probably damaging Het
Rrp8 T C 7: 105,734,804 R164G probably benign Het
Sacs T A 14: 61,207,759 I2418K probably benign Het
Scrn1 T C 6: 54,525,646 E136G probably benign Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Slitrk6 C T 14: 110,751,955 A107T probably damaging Het
Tktl2 T A 8: 66,513,143 F451Y probably damaging Het
Tnks1bp1 G A 2: 85,058,915 V529M probably benign Het
Trps1 T C 15: 50,661,346 K874E probably damaging Het
Ttll9 T A 2: 152,983,127 D75E probably benign Het
Ttn A G 2: 76,766,024 Y20182H probably damaging Het
Ufc1 A T 1: 171,289,248 C116S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zfp809 A G 9: 22,238,680 K158E possibly damaging Het
Zfp81 A G 17: 33,334,623 Y406H probably damaging Het
Other mutations in Myom2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom2 APN 8 15069490 missense probably damaging 1.00
IGL00426:Myom2 APN 8 15069502 missense probably benign 0.00
IGL00503:Myom2 APN 8 15114289 splice site probably null
IGL01515:Myom2 APN 8 15122655 missense probably benign 0.15
IGL01649:Myom2 APN 8 15113755 missense probably benign 0.24
IGL01658:Myom2 APN 8 15077880 missense probably damaging 1.00
IGL01786:Myom2 APN 8 15106330 missense probably damaging 0.99
IGL01924:Myom2 APN 8 15069685 missense probably benign 0.37
IGL01929:Myom2 APN 8 15117698 missense probably damaging 0.96
IGL02016:Myom2 APN 8 15125195 missense probably benign 0.01
IGL02511:Myom2 APN 8 15065743 missense probably benign
IGL02558:Myom2 APN 8 15114237 missense probably benign 0.31
IGL02944:Myom2 APN 8 15104065 critical splice acceptor site probably null
IGL03052:Myom2 APN 8 15123442 splice site probably benign
IGL03195:Myom2 APN 8 15111844 nonsense probably null
IGL03288:Myom2 APN 8 15122679 missense probably damaging 0.99
IGL03402:Myom2 APN 8 15065731 missense probably benign
R0069:Myom2 UTSW 8 15117624 missense probably benign
R0116:Myom2 UTSW 8 15117633 missense probably damaging 1.00
R0131:Myom2 UTSW 8 15083329 missense probably damaging 0.98
R0373:Myom2 UTSW 8 15098419 missense possibly damaging 0.91
R0463:Myom2 UTSW 8 15104123 missense probably benign 0.09
R0544:Myom2 UTSW 8 15069796 missense probably damaging 1.00
R0629:Myom2 UTSW 8 15069783 missense probably damaging 0.98
R0634:Myom2 UTSW 8 15119216 splice site probably benign
R0645:Myom2 UTSW 8 15117698 missense probably damaging 0.96
R0730:Myom2 UTSW 8 15099326 missense probably benign 0.00
R0744:Myom2 UTSW 8 15132924 nonsense probably null
R0836:Myom2 UTSW 8 15132924 nonsense probably null
R1033:Myom2 UTSW 8 15108934 missense probably benign 0.04
R1103:Myom2 UTSW 8 15110827 missense probably benign 0.22
R1110:Myom2 UTSW 8 15122413 missense probably benign 0.44
R1208:Myom2 UTSW 8 15084631 missense probably damaging 1.00
R1208:Myom2 UTSW 8 15084631 missense probably damaging 1.00
R1353:Myom2 UTSW 8 15106424 missense probably damaging 1.00
R1530:Myom2 UTSW 8 15122384 missense probably damaging 1.00
R1544:Myom2 UTSW 8 15104059 splice site probably benign
R1576:Myom2 UTSW 8 15084556 missense probably damaging 1.00
R1758:Myom2 UTSW 8 15065795 missense probably benign 0.00
R1884:Myom2 UTSW 8 15114278 missense probably benign 0.01
R1908:Myom2 UTSW 8 15081023 missense probably damaging 1.00
R1962:Myom2 UTSW 8 15132599 intron probably null
R1977:Myom2 UTSW 8 15085263 missense possibly damaging 0.47
R2018:Myom2 UTSW 8 15131151 missense probably damaging 1.00
R2049:Myom2 UTSW 8 15106379 missense probably damaging 0.97
R2155:Myom2 UTSW 8 15084555 missense probably damaging 0.98
R2350:Myom2 UTSW 8 15108835 missense probably benign 0.09
R2358:Myom2 UTSW 8 15112018 missense possibly damaging 0.68
R2904:Myom2 UTSW 8 15098348 missense probably benign 0.00
R3418:Myom2 UTSW 8 15085294 missense probably benign 0.01
R3606:Myom2 UTSW 8 15069775 missense probably damaging 1.00
R3607:Myom2 UTSW 8 15069775 missense probably damaging 1.00
R3735:Myom2 UTSW 8 15069676 missense probably benign 0.01
R3756:Myom2 UTSW 8 15102650 missense probably benign 0.11
R3902:Myom2 UTSW 8 15104165 missense probably benign
R3951:Myom2 UTSW 8 15084556 missense probably benign 0.35
R4240:Myom2 UTSW 8 15132895 missense probably benign 0.10
R4361:Myom2 UTSW 8 15112018 missense possibly damaging 0.68
R4581:Myom2 UTSW 8 15106459 missense probably benign 0.02
R4736:Myom2 UTSW 8 15081271 missense probably damaging 0.99
R5010:Myom2 UTSW 8 15083310 missense probably damaging 0.98
R5108:Myom2 UTSW 8 15132667 missense probably damaging 0.99
R5370:Myom2 UTSW 8 15099343 missense probably benign 0.10
R5427:Myom2 UTSW 8 15113764 missense probably benign 0.03
R5498:Myom2 UTSW 8 15129142 missense probably benign 0.01
R5504:Myom2 UTSW 8 15128879 missense probably damaging 1.00
R5567:Myom2 UTSW 8 15102546 missense probably benign 0.01
R5743:Myom2 UTSW 8 15080914 missense possibly damaging 0.82
R5745:Myom2 UTSW 8 15122705 missense probably benign 0.01
R5844:Myom2 UTSW 8 15131182 critical splice donor site probably null
R5854:Myom2 UTSW 8 15108478 missense probably benign
R6141:Myom2 UTSW 8 15063903 missense probably damaging 1.00
R6209:Myom2 UTSW 8 15104173 missense possibly damaging 0.76
R6248:Myom2 UTSW 8 15098472 splice site probably null
R6378:Myom2 UTSW 8 15099356 missense probably benign 0.11
R6829:Myom2 UTSW 8 15122643 nonsense probably null
R6913:Myom2 UTSW 8 15065710 missense probably benign
R6957:Myom2 UTSW 8 15117741 missense probably null 0.42
R6958:Myom2 UTSW 8 15117741 missense probably null 0.42
R6960:Myom2 UTSW 8 15117741 missense probably null 0.42
R6961:Myom2 UTSW 8 15117741 missense probably null 0.42
R6962:Myom2 UTSW 8 15117741 missense probably null 0.42
R6999:Myom2 UTSW 8 15084531 missense probably benign 0.22
R7148:Myom2 UTSW 8 15084577 missense possibly damaging 0.72
R7210:Myom2 UTSW 8 15104114 missense probably damaging 1.00
R7298:Myom2 UTSW 8 15098411 missense probably damaging 1.00
R7463:Myom2 UTSW 8 15117679 missense probably null 0.94
R7535:Myom2 UTSW 8 15117679 missense probably damaging 1.00
R7573:Myom2 UTSW 8 15122450 missense probably damaging 1.00
R7590:Myom2 UTSW 8 15117679 missense probably damaging 1.00
R7690:Myom2 UTSW 8 15111717 critical splice acceptor site probably null
R7794:Myom2 UTSW 8 15083259 missense probably damaging 1.00
R7822:Myom2 UTSW 8 15108454 missense probably benign
R7948:Myom2 UTSW 8 15085306 missense probably benign 0.00
R8094:Myom2 UTSW 8 15069418 missense possibly damaging 0.94
R8268:Myom2 UTSW 8 15129157 missense probably damaging 1.00
R8292:Myom2 UTSW 8 15132888 missense probably benign 0.01
RF001:Myom2 UTSW 8 15081418 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- ATGCATGTCTGTCTGTCTGTC -3'
(R):5'- GCCATTCAACCCAACTGACTTC -3'

Sequencing Primer
(F):5'- TTATTGCCCTGAGACAAGGC -3'
(R):5'- GGGATATGTACATCAGAGATGCTCTC -3'
Posted On2014-10-30