Incidental Mutation 'R2314:Polb'
ID245413
Institutional Source Beutler Lab
Gene Symbol Polb
Ensembl Gene ENSMUSG00000031536
Gene Namepolymerase (DNA directed), beta
SynonymsPol beta, A430088C08Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2314 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location22628126-22653435 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 22640002 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 185 (A185S)
Ref Sequence ENSEMBL: ENSMUSP00000033938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033938] [ENSMUST00000210950]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033938
AA Change: A185S

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000033938
Gene: ENSMUSG00000031536
AA Change: A185S

DomainStartEndE-ValueType
POLXc 10 334 4.58e-159 SMART
HhH1 57 76 1.91e-1 SMART
HhH1 98 117 1.14e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181668
Predicted Effect probably benign
Transcript: ENSMUST00000210950
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA polymerase involved in base excision and repair, also called gap-filling DNA synthesis. The encoded protein, acting as a monomer, is normally found in the cytoplasm, but it translocates to the nucleus upon DNA damage. Several transcript variants of this gene exist, but the full-length nature of only one has been described to date. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for one knock-out allele die from E10.5 to birth and those for another one exhibit embryonic growth retardation, abnormal neurogenesis, and neonatal lethality due to respiratory failure. Hypomorphic allele mice develop systemic lupus erythematosus-like phentoypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,684,702 S466G probably benign Het
Aasdhppt A G 9: 4,309,322 S39P probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Anxa6 T A 11: 55,011,735 I58F probably damaging Het
Ccdc30 T A 4: 119,324,566 K582* probably null Het
Cebpz A G 17: 78,920,547 probably null Het
Clstn3 T A 6: 124,450,717 D473V probably benign Het
Cry1 A T 10: 85,133,311 C550S probably benign Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dolk G T 2: 30,285,485 L183M probably damaging Het
Dpys T C 15: 39,828,090 T279A possibly damaging Het
Drd4 T C 7: 141,293,941 Y140H probably damaging Het
Duox1 C A 2: 122,333,730 C890* probably null Het
Epha2 T A 4: 141,319,014 V508E probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fahd1 A T 17: 24,849,596 I169N probably damaging Het
Fgfr1 C T 8: 25,570,893 S527F probably damaging Het
Flywch1 A G 17: 23,763,026 V68A probably benign Het
Gm21834 A T 17: 57,742,215 V2E possibly damaging Het
Gm7853 A T 14: 36,089,664 noncoding transcript Het
Igf2r T A 17: 12,715,943 H713L probably benign Het
Iqgap3 T C 3: 88,116,031 V543A probably benign Het
Kcnq5 T A 1: 21,479,371 probably null Het
Lsm1 C T 8: 25,785,684 P5S possibly damaging Het
March1 T C 8: 66,121,790 M1T probably null Het
Myocd T C 11: 65,200,807 H103R probably damaging Het
Myom2 C T 8: 15,063,927 T25I probably damaging Het
Nck1 T C 9: 100,497,950 K83E probably damaging Het
Nid2 A G 14: 19,789,761 D806G probably benign Het
Olfr639 T A 7: 104,012,229 M158L probably benign Het
Onecut2 G T 18: 64,341,197 R254L probably damaging Het
Plxna1 A C 6: 89,324,316 L1534R probably damaging Het
Pou3f3 T C 1: 42,698,491 V449A probably damaging Het
Pskh1 C T 8: 105,913,513 T275I probably damaging Het
Rab18 C A 18: 6,788,516 A161D probably damaging Het
Rrp8 T C 7: 105,734,804 R164G probably benign Het
Sacs T A 14: 61,207,759 I2418K probably benign Het
Scrn1 T C 6: 54,525,646 E136G probably benign Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Slitrk6 C T 14: 110,751,955 A107T probably damaging Het
Tktl2 T A 8: 66,513,143 F451Y probably damaging Het
Tnks1bp1 G A 2: 85,058,915 V529M probably benign Het
Trps1 T C 15: 50,661,346 K874E probably damaging Het
Ttll9 T A 2: 152,983,127 D75E probably benign Het
Ttn A G 2: 76,766,024 Y20182H probably damaging Het
Ufc1 A T 1: 171,289,248 C116S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zfp809 A G 9: 22,238,680 K158E possibly damaging Het
Zfp81 A G 17: 33,334,623 Y406H probably damaging Het
Other mutations in Polb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Polb APN 8 22653072 missense probably damaging 1.00
IGL02421:Polb APN 8 22640373 missense probably damaging 1.00
IGL02618:Polb APN 8 22637093 missense probably damaging 1.00
IGL02850:Polb APN 8 22648261 splice site probably benign
IGL03143:Polb APN 8 22640351 splice site probably benign
IGL02796:Polb UTSW 8 22631458 missense probably damaging 1.00
R0280:Polb UTSW 8 22640392 missense probably damaging 0.99
R0383:Polb UTSW 8 22639995 nonsense probably null
R0788:Polb UTSW 8 22642338 missense probably null
R1374:Polb UTSW 8 22653057 splice site probably benign
R1564:Polb UTSW 8 22630341 critical splice donor site probably null
R2194:Polb UTSW 8 22647467 missense probably benign 0.05
R2295:Polb UTSW 8 22653319 missense probably damaging 1.00
R4992:Polb UTSW 8 22645071 missense probably damaging 0.97
R5107:Polb UTSW 8 22645046 splice site probably null
R5474:Polb UTSW 8 22630370 missense probably benign 0.13
R5905:Polb UTSW 8 22639995 nonsense probably null
R5908:Polb UTSW 8 22642303 critical splice donor site probably null
R6028:Polb UTSW 8 22639995 nonsense probably null
R6188:Polb UTSW 8 22647447 missense probably damaging 0.99
R7304:Polb UTSW 8 22639959 missense probably benign
R7644:Polb UTSW 8 22640427 missense probably benign 0.02
R7766:Polb UTSW 8 22653091 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TTTGCAGCAATACTCTGTGTG -3'
(R):5'- GTCTCTGTCATTGCACCTGAG -3'

Sequencing Primer
(F):5'- ATGAGGCCCTGAGTTCAATC -3'
(R):5'- CCTGAGTGATTAGACAGACAATGG -3'
Posted On2014-10-30