Incidental Mutation 'R2314:Fgfr1'
ID245414
Institutional Source Beutler Lab
Gene Symbol Fgfr1
Ensembl Gene ENSMUSG00000031565
Gene Namefibroblast growth factor receptor 1
SynonymsEask, Hspy, Fgfr-1, Flt-2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2314 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location25513654-25575718 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25570893 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 527 (S527F)
Ref Sequence ENSEMBL: ENSMUSP00000137515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084027] [ENSMUST00000117179] [ENSMUST00000119398] [ENSMUST00000167764] [ENSMUST00000178276] [ENSMUST00000179592]
PDB Structure NMR STRUCTURE OF THE FIRST IG MODULE OF MOUSE FGFR1 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000084027
AA Change: S616F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081041
Gene: ENSMUSG00000031565
AA Change: S616F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 46 108 2.94e-10 SMART
low complexity region 124 138 N/A INTRINSIC
IGc2 169 237 4.09e-9 SMART
IGc2 268 348 1.26e-9 SMART
transmembrane domain 375 397 N/A INTRINSIC
low complexity region 439 453 N/A INTRINSIC
TyrKc 478 754 1.51e-155 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117179
AA Change: S614F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113909
Gene: ENSMUSG00000031565
AA Change: S614F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 46 108 2.94e-10 SMART
low complexity region 124 138 N/A INTRINSIC
IGc2 167 235 4.09e-9 SMART
IGc2 266 346 1.26e-9 SMART
transmembrane domain 373 395 N/A INTRINSIC
low complexity region 437 451 N/A INTRINSIC
TyrKc 476 752 1.51e-155 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119398
AA Change: S527F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113855
Gene: ENSMUSG00000031565
AA Change: S527F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 35 49 N/A INTRINSIC
IGc2 80 148 4.09e-9 SMART
IGc2 179 259 1.26e-9 SMART
transmembrane domain 286 308 N/A INTRINSIC
low complexity region 350 364 N/A INTRINSIC
TyrKc 389 665 1.51e-155 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120106
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126118
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133936
Predicted Effect probably benign
Transcript: ENSMUST00000138104
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145218
Predicted Effect probably damaging
Transcript: ENSMUST00000167764
AA Change: S527F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131343
Gene: ENSMUSG00000031565
AA Change: S527F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 35 49 N/A INTRINSIC
IGc2 78 146 4.09e-9 SMART
IGc2 177 255 1.22e-7 SMART
transmembrane domain 286 308 N/A INTRINSIC
low complexity region 350 364 N/A INTRINSIC
TyrKc 389 665 1.51e-155 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178276
AA Change: S527F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137515
Gene: ENSMUSG00000031565
AA Change: S527F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 35 49 N/A INTRINSIC
IGc2 78 146 4.09e-9 SMART
IGc2 177 255 1.22e-7 SMART
transmembrane domain 286 308 N/A INTRINSIC
low complexity region 350 364 N/A INTRINSIC
TyrKc 389 665 1.51e-155 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179592
AA Change: S627F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136640
Gene: ENSMUSG00000031565
AA Change: S627F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 59 121 2.94e-10 SMART
low complexity region 137 151 N/A INTRINSIC
IGc2 180 248 4.09e-9 SMART
IGc2 279 359 1.26e-9 SMART
transmembrane domain 386 408 N/A INTRINSIC
low complexity region 450 464 N/A INTRINSIC
TyrKc 489 765 1.51e-155 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211419
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member binds both acidic and basic fibroblast growth factors and is involved in limb induction. Mutations in this gene have been associated with Pfeiffer syndrome, Jackson-Weiss syndrome, Antley-Bixler syndrome, osteoglophonic dysplasia, and autosomal dominant Kallmann syndrome 2. Chromosomal aberrations involving this gene are associated with stem cell myeloproliferative disorder and stem cell leukemia lymphoma syndrome. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die around gastrulation and show defective patterning of axial structures. Hypomorphic and selectively ablated mutations exhibit a wide range of abnormalities affecting diverse structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,684,702 S466G probably benign Het
Aasdhppt A G 9: 4,309,322 S39P probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Anxa6 T A 11: 55,011,735 I58F probably damaging Het
Ccdc30 T A 4: 119,324,566 K582* probably null Het
Cebpz A G 17: 78,920,547 probably null Het
Clstn3 T A 6: 124,450,717 D473V probably benign Het
Cry1 A T 10: 85,133,311 C550S probably benign Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dolk G T 2: 30,285,485 L183M probably damaging Het
Dpys T C 15: 39,828,090 T279A possibly damaging Het
Drd4 T C 7: 141,293,941 Y140H probably damaging Het
Duox1 C A 2: 122,333,730 C890* probably null Het
Epha2 T A 4: 141,319,014 V508E probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fahd1 A T 17: 24,849,596 I169N probably damaging Het
Flywch1 A G 17: 23,763,026 V68A probably benign Het
Gm21834 A T 17: 57,742,215 V2E possibly damaging Het
Gm7853 A T 14: 36,089,664 noncoding transcript Het
Igf2r T A 17: 12,715,943 H713L probably benign Het
Iqgap3 T C 3: 88,116,031 V543A probably benign Het
Kcnq5 T A 1: 21,479,371 probably null Het
Lsm1 C T 8: 25,785,684 P5S possibly damaging Het
March1 T C 8: 66,121,790 M1T probably null Het
Myocd T C 11: 65,200,807 H103R probably damaging Het
Myom2 C T 8: 15,063,927 T25I probably damaging Het
Nck1 T C 9: 100,497,950 K83E probably damaging Het
Nid2 A G 14: 19,789,761 D806G probably benign Het
Olfr639 T A 7: 104,012,229 M158L probably benign Het
Onecut2 G T 18: 64,341,197 R254L probably damaging Het
Plxna1 A C 6: 89,324,316 L1534R probably damaging Het
Polb C A 8: 22,640,002 A185S possibly damaging Het
Pou3f3 T C 1: 42,698,491 V449A probably damaging Het
Pskh1 C T 8: 105,913,513 T275I probably damaging Het
Rab18 C A 18: 6,788,516 A161D probably damaging Het
Rrp8 T C 7: 105,734,804 R164G probably benign Het
Sacs T A 14: 61,207,759 I2418K probably benign Het
Scrn1 T C 6: 54,525,646 E136G probably benign Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Slitrk6 C T 14: 110,751,955 A107T probably damaging Het
Tktl2 T A 8: 66,513,143 F451Y probably damaging Het
Tnks1bp1 G A 2: 85,058,915 V529M probably benign Het
Trps1 T C 15: 50,661,346 K874E probably damaging Het
Ttll9 T A 2: 152,983,127 D75E probably benign Het
Ttn A G 2: 76,766,024 Y20182H probably damaging Het
Ufc1 A T 1: 171,289,248 C116S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zfp809 A G 9: 22,238,680 K158E possibly damaging Het
Zfp81 A G 17: 33,334,623 Y406H probably damaging Het
Other mutations in Fgfr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Fgfr1 APN 8 25562223 nonsense probably null
IGL01537:Fgfr1 APN 8 25555579 missense probably damaging 1.00
IGL01643:Fgfr1 APN 8 25566735 missense probably benign 0.01
IGL01875:Fgfr1 APN 8 25573553 missense possibly damaging 0.81
IGL02002:Fgfr1 APN 8 25555711 missense probably damaging 1.00
IGL02698:Fgfr1 APN 8 25573608 nonsense probably null
IGL02822:Fgfr1 APN 8 25557802 missense probably benign 0.13
IGL03292:Fgfr1 APN 8 25557755 missense possibly damaging 0.50
R0003:Fgfr1 UTSW 8 25568198 missense possibly damaging 0.80
R0723:Fgfr1 UTSW 8 25557768 missense probably damaging 0.99
R0730:Fgfr1 UTSW 8 25555744 missense probably benign
R1144:Fgfr1 UTSW 8 25558143 missense probably damaging 1.00
R1455:Fgfr1 UTSW 8 25562276 missense possibly damaging 0.81
R1591:Fgfr1 UTSW 8 25572720 missense probably damaging 1.00
R1754:Fgfr1 UTSW 8 25570210 missense probably damaging 1.00
R2045:Fgfr1 UTSW 8 25558215 missense probably benign 0.04
R2139:Fgfr1 UTSW 8 25570866 missense probably damaging 1.00
R2517:Fgfr1 UTSW 8 25563446 missense probably damaging 1.00
R2982:Fgfr1 UTSW 8 25558211 missense probably benign 0.04
R3796:Fgfr1 UTSW 8 25572437 missense probably damaging 1.00
R3797:Fgfr1 UTSW 8 25572437 missense probably damaging 1.00
R3799:Fgfr1 UTSW 8 25572437 missense probably damaging 1.00
R4323:Fgfr1 UTSW 8 25573899 missense probably benign 0.37
R4594:Fgfr1 UTSW 8 25573836 missense probably damaging 0.99
R4614:Fgfr1 UTSW 8 25557797 missense probably benign 0.25
R4696:Fgfr1 UTSW 8 25563488 missense probably damaging 0.99
R4916:Fgfr1 UTSW 8 25563526 critical splice donor site probably null
R4966:Fgfr1 UTSW 8 25572445 nonsense probably null
R5094:Fgfr1 UTSW 8 25570165 missense probably damaging 1.00
R5730:Fgfr1 UTSW 8 25573811 missense probably damaging 1.00
R5911:Fgfr1 UTSW 8 25519309 utr 5 prime probably benign
R7310:Fgfr1 UTSW 8 25562315 missense probably benign 0.01
R7326:Fgfr1 UTSW 8 25573839 missense probably damaging 1.00
R7404:Fgfr1 UTSW 8 25555550 missense probably benign
R7611:Fgfr1 UTSW 8 25558205 nonsense probably null
R7681:Fgfr1 UTSW 8 25555661 missense probably damaging 0.98
R7738:Fgfr1 UTSW 8 25558185 missense probably damaging 0.96
R7789:Fgfr1 UTSW 8 25562313 nonsense probably null
R7958:Fgfr1 UTSW 8 25532342 missense probably benign
R8206:Fgfr1 UTSW 8 25570242 missense probably damaging 1.00
R8236:Fgfr1 UTSW 8 25562272 nonsense probably null
R8691:Fgfr1 UTSW 8 25562237 missense possibly damaging 0.95
Z1177:Fgfr1 UTSW 8 25563398 missense probably benign 0.00
Z1177:Fgfr1 UTSW 8 25570768 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CAGTGGACTATGGCATCAGGAG -3'
(R):5'- TTAACAGGTGTAAGCTGGGG -3'

Sequencing Primer
(F):5'- GACCTATTGCCTGACCTGTGG -3'
(R):5'- GACAGATATAGTAGCCCGTGTTAAC -3'
Posted On2014-10-30