Incidental Mutation 'R2314:Tktl2'
ID245417
Institutional Source Beutler Lab
Gene Symbol Tktl2
Ensembl Gene ENSMUSG00000025519
Gene Nametransketolase-like 2
Synonyms4933401I19Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.497) question?
Stock #R2314 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location66511756-66518335 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66513143 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 451 (F451Y)
Ref Sequence ENSEMBL: ENSMUSP00000138388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002025] [ENSMUST00000183187]
Predicted Effect probably damaging
Transcript: ENSMUST00000002025
AA Change: F451Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002025
Gene: ENSMUSG00000025519
AA Change: F451Y

DomainStartEndE-ValueType
Pfam:DXP_synthase_N 2 195 2.4e-9 PFAM
Pfam:Transketolase_N 16 281 4.6e-50 PFAM
Pfam:TPP_enzyme_C 108 250 5.9e-8 PFAM
Pfam:E1_dh 111 249 2.9e-13 PFAM
Transket_pyr 320 484 3.74e-51 SMART
Pfam:Transketolase_C 495 617 1.4e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183187
AA Change: F451Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138388
Gene: ENSMUSG00000025519
AA Change: F451Y

DomainStartEndE-ValueType
Pfam:DXP_synthase_N 2 197 8.2e-9 PFAM
Pfam:Transketolase_N 16 280 2.2e-86 PFAM
Pfam:TPP_enzyme_C 108 250 5.9e-8 PFAM
Pfam:E1_dh 110 251 2.1e-14 PFAM
Transket_pyr 320 484 3.74e-51 SMART
Pfam:Transketolase_C 495 617 3.4e-30 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,684,702 S466G probably benign Het
Aasdhppt A G 9: 4,309,322 S39P probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Anxa6 T A 11: 55,011,735 I58F probably damaging Het
Ccdc30 T A 4: 119,324,566 K582* probably null Het
Cebpz A G 17: 78,920,547 probably null Het
Clstn3 T A 6: 124,450,717 D473V probably benign Het
Cry1 A T 10: 85,133,311 C550S probably benign Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dolk G T 2: 30,285,485 L183M probably damaging Het
Dpys T C 15: 39,828,090 T279A possibly damaging Het
Drd4 T C 7: 141,293,941 Y140H probably damaging Het
Duox1 C A 2: 122,333,730 C890* probably null Het
Epha2 T A 4: 141,319,014 V508E probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fahd1 A T 17: 24,849,596 I169N probably damaging Het
Fgfr1 C T 8: 25,570,893 S527F probably damaging Het
Flywch1 A G 17: 23,763,026 V68A probably benign Het
Gm21834 A T 17: 57,742,215 V2E possibly damaging Het
Gm7853 A T 14: 36,089,664 noncoding transcript Het
Igf2r T A 17: 12,715,943 H713L probably benign Het
Iqgap3 T C 3: 88,116,031 V543A probably benign Het
Kcnq5 T A 1: 21,479,371 probably null Het
Lsm1 C T 8: 25,785,684 P5S possibly damaging Het
March1 T C 8: 66,121,790 M1T probably null Het
Myocd T C 11: 65,200,807 H103R probably damaging Het
Myom2 C T 8: 15,063,927 T25I probably damaging Het
Nck1 T C 9: 100,497,950 K83E probably damaging Het
Nid2 A G 14: 19,789,761 D806G probably benign Het
Olfr639 T A 7: 104,012,229 M158L probably benign Het
Onecut2 G T 18: 64,341,197 R254L probably damaging Het
Plxna1 A C 6: 89,324,316 L1534R probably damaging Het
Polb C A 8: 22,640,002 A185S possibly damaging Het
Pou3f3 T C 1: 42,698,491 V449A probably damaging Het
Pskh1 C T 8: 105,913,513 T275I probably damaging Het
Rab18 C A 18: 6,788,516 A161D probably damaging Het
Rrp8 T C 7: 105,734,804 R164G probably benign Het
Sacs T A 14: 61,207,759 I2418K probably benign Het
Scrn1 T C 6: 54,525,646 E136G probably benign Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Slitrk6 C T 14: 110,751,955 A107T probably damaging Het
Tnks1bp1 G A 2: 85,058,915 V529M probably benign Het
Trps1 T C 15: 50,661,346 K874E probably damaging Het
Ttll9 T A 2: 152,983,127 D75E probably benign Het
Ttn A G 2: 76,766,024 Y20182H probably damaging Het
Ufc1 A T 1: 171,289,248 C116S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zfp809 A G 9: 22,238,680 K158E possibly damaging Het
Zfp81 A G 17: 33,334,623 Y406H probably damaging Het
Other mutations in Tktl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Tktl2 APN 8 66512896 missense probably benign 0.00
IGL02444:Tktl2 APN 8 66513361 missense possibly damaging 0.60
IGL02798:Tktl2 APN 8 66513311 missense probably benign 0.06
IGL02938:Tktl2 APN 8 66512330 missense probably damaging 1.00
IGL03095:Tktl2 APN 8 66512284 missense probably damaging 1.00
R0530:Tktl2 UTSW 8 66513179 missense probably damaging 0.99
R0899:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R0900:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R1080:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R1419:Tktl2 UTSW 8 66513038 missense probably damaging 0.97
R1609:Tktl2 UTSW 8 66512852 missense probably benign 0.04
R1717:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R1718:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R1719:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R1848:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R1933:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R1934:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R2134:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R2135:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R2509:Tktl2 UTSW 8 66512852 missense probably benign 0.04
R2511:Tktl2 UTSW 8 66512852 missense probably benign 0.04
R2965:Tktl2 UTSW 8 66512063 missense probably benign 0.01
R3084:Tktl2 UTSW 8 66513206 missense possibly damaging 0.88
R3085:Tktl2 UTSW 8 66513206 missense possibly damaging 0.88
R3121:Tktl2 UTSW 8 66512156 missense probably damaging 0.98
R3499:Tktl2 UTSW 8 66513245 missense probably damaging 0.97
R4227:Tktl2 UTSW 8 66513699 splice site probably null
R4284:Tktl2 UTSW 8 66513156 missense probably damaging 1.00
R4491:Tktl2 UTSW 8 66512012 missense probably damaging 0.96
R5478:Tktl2 UTSW 8 66513398 missense probably damaging 0.99
R5801:Tktl2 UTSW 8 66513647 missense probably benign 0.00
R6656:Tktl2 UTSW 8 66512729 missense probably benign
R6864:Tktl2 UTSW 8 66512339 missense probably damaging 1.00
R6915:Tktl2 UTSW 8 66513035 missense probably damaging 1.00
R7168:Tktl2 UTSW 8 66513101 missense probably damaging 1.00
R7442:Tktl2 UTSW 8 66512909 missense possibly damaging 0.95
R7617:Tktl2 UTSW 8 66512999 missense probably benign 0.07
R7687:Tktl2 UTSW 8 66513101 missense probably damaging 1.00
R8825:Tktl2 UTSW 8 66513667 missense possibly damaging 0.87
RF006:Tktl2 UTSW 8 66512852 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- CGAGGACGAACTATTGCTTTCG -3'
(R):5'- ATGCAGAGTAACCCCTGCTC -3'

Sequencing Primer
(F):5'- GACGAACTATTGCTTTCGTTAGTACC -3'
(R):5'- AATAACTGTCACCTTGTCGACTG -3'
Posted On2014-10-30