Incidental Mutation 'R2314:Nck1'
ID245422
Institutional Source Beutler Lab
Gene Symbol Nck1
Ensembl Gene ENSMUSG00000032475
Gene Namenon-catalytic region of tyrosine kinase adaptor protein 1
SynonymsD230010O13Rik, 6330586M15Rik, Nck
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2314 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location100492293-100546134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100497950 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 83 (K83E)
Ref Sequence ENSEMBL: ENSMUSP00000112221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112874] [ENSMUST00000116522] [ENSMUST00000186591] [ENSMUST00000188670]
Predicted Effect probably damaging
Transcript: ENSMUST00000112874
AA Change: K19E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108495
Gene: ENSMUSG00000032475
AA Change: K19E

DomainStartEndE-ValueType
SH3 45 100 3.58e-18 SMART
SH3 129 187 2.65e-21 SMART
SH2 216 298 1.6e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116522
AA Change: K83E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112221
Gene: ENSMUSG00000032475
AA Change: K83E

DomainStartEndE-ValueType
SH3 5 60 3.99e-16 SMART
SH3 109 164 3.58e-18 SMART
SH3 193 251 2.65e-21 SMART
SH2 280 362 1.6e-31 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000186591
AA Change: K83E

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140971
Gene: ENSMUSG00000032475
AA Change: K83E

DomainStartEndE-ValueType
SH3 5 60 2.5e-18 SMART
SH3 109 164 2.2e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188670
AA Change: K83E

PolyPhen 2 Score 0.263 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140143
Gene: ENSMUSG00000032475
AA Change: K83E

DomainStartEndE-ValueType
SH3 5 60 2.5e-18 SMART
PDB:2CUB|A 99 132 2e-17 PDB
Blast:SH3 109 132 2e-8 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the signaling and transforming proteins containing Src homology 2 and 3 (SH2 and SH3) domains. It is located in the cytoplasm and is an adaptor protein involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as RAS. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for disruption of this gene display no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,684,702 S466G probably benign Het
Aasdhppt A G 9: 4,309,322 S39P probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Anxa6 T A 11: 55,011,735 I58F probably damaging Het
Ccdc30 T A 4: 119,324,566 K582* probably null Het
Cebpz A G 17: 78,920,547 probably null Het
Clstn3 T A 6: 124,450,717 D473V probably benign Het
Cry1 A T 10: 85,133,311 C550S probably benign Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dolk G T 2: 30,285,485 L183M probably damaging Het
Dpys T C 15: 39,828,090 T279A possibly damaging Het
Drd4 T C 7: 141,293,941 Y140H probably damaging Het
Duox1 C A 2: 122,333,730 C890* probably null Het
Epha2 T A 4: 141,319,014 V508E probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fahd1 A T 17: 24,849,596 I169N probably damaging Het
Fgfr1 C T 8: 25,570,893 S527F probably damaging Het
Flywch1 A G 17: 23,763,026 V68A probably benign Het
Gm21834 A T 17: 57,742,215 V2E possibly damaging Het
Gm7853 A T 14: 36,089,664 noncoding transcript Het
Igf2r T A 17: 12,715,943 H713L probably benign Het
Iqgap3 T C 3: 88,116,031 V543A probably benign Het
Kcnq5 T A 1: 21,479,371 probably null Het
Lsm1 C T 8: 25,785,684 P5S possibly damaging Het
March1 T C 8: 66,121,790 M1T probably null Het
Myocd T C 11: 65,200,807 H103R probably damaging Het
Myom2 C T 8: 15,063,927 T25I probably damaging Het
Nid2 A G 14: 19,789,761 D806G probably benign Het
Olfr639 T A 7: 104,012,229 M158L probably benign Het
Onecut2 G T 18: 64,341,197 R254L probably damaging Het
Plxna1 A C 6: 89,324,316 L1534R probably damaging Het
Polb C A 8: 22,640,002 A185S possibly damaging Het
Pou3f3 T C 1: 42,698,491 V449A probably damaging Het
Pskh1 C T 8: 105,913,513 T275I probably damaging Het
Rab18 C A 18: 6,788,516 A161D probably damaging Het
Rrp8 T C 7: 105,734,804 R164G probably benign Het
Sacs T A 14: 61,207,759 I2418K probably benign Het
Scrn1 T C 6: 54,525,646 E136G probably benign Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Slitrk6 C T 14: 110,751,955 A107T probably damaging Het
Tktl2 T A 8: 66,513,143 F451Y probably damaging Het
Tnks1bp1 G A 2: 85,058,915 V529M probably benign Het
Trps1 T C 15: 50,661,346 K874E probably damaging Het
Ttll9 T A 2: 152,983,127 D75E probably benign Het
Ttn A G 2: 76,766,024 Y20182H probably damaging Het
Ufc1 A T 1: 171,289,248 C116S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zfp809 A G 9: 22,238,680 K158E possibly damaging Het
Zfp81 A G 17: 33,334,623 Y406H probably damaging Het
Other mutations in Nck1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Nck1 APN 9 100497737 missense probably damaging 1.00
IGL01608:Nck1 APN 9 100497387 missense probably benign
IGL02711:Nck1 APN 9 100508620 missense probably damaging 1.00
Cuchillo UTSW 9 100497737 missense probably damaging 1.00
Tenedor UTSW 9 100508527 missense probably damaging 1.00
R0211:Nck1 UTSW 9 100497767 missense probably damaging 1.00
R0211:Nck1 UTSW 9 100497767 missense probably damaging 1.00
R1549:Nck1 UTSW 9 100497872 missense probably benign
R2128:Nck1 UTSW 9 100497547 splice site probably null
R4744:Nck1 UTSW 9 100506744 missense probably benign
R8178:Nck1 UTSW 9 100497737 missense probably damaging 1.00
R8674:Nck1 UTSW 9 100508527 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTTGTCCGTTGTAGCTGCC -3'
(R):5'- CTTGGCTTTAGCAGGAGAAAAG -3'

Sequencing Primer
(F):5'- TTGTAGCTGCCACGCCAC -3'
(R):5'- GATCCATCATGTCATAGTCTG -3'
Posted On2014-10-30