Mutagenetix > Incidental Mutation

Incidental Mutation 'R2314:Sgk1'

245423

Institutional Source

Beutler Lab

Gene Symbol

Sgk1

Ensembl Gene

ENSMUSG00000019970

Gene Name

serum/glucocorticoid regulated kinase 1

Synonyms

Sgk, Sgk1

Accession Numbers

Ncbi RefSeq: NM_001161845.2, NM_001161847.2, NM_001161848.2, NM_001161849.2, NM_001161850.2, NM_011361.3; MGI:1340062

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2314 (G1)

Quality Score

179

Status

Not validated

Chromosome

Chromosomal Location

21882184-21999903 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 21996601 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 171 (R171W)

Ref Sequence

ENSEMBL: ENSMUSP00000128873 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020145] [ENSMUST00000092673] [ENSMUST00000100036] [ENSMUST00000120509] [ENSMUST00000124350] [ENSMUST00000142174] [ENSMUST00000150089] [ENSMUST00000164659]

AlphaFold

Q9WVC6

Predicted Effect

probably damaging
Transcript: ENSMUST00000020145
AA Change: R198W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020145
Gene: ENSMUSG00000019970
AA Change: R198W

Domain	Start	End	E-Value	Type
Blast:S_TKc	36	72	4e-10	BLAST
low complexity region	73	80	N/A	INTRINSIC
S_TKc	98	355	6.15e-106	SMART
S_TK_X	356	425	2.51e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000092673
AA Change: R212W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000090343
Gene: ENSMUSG00000019970
AA Change: R212W

Domain	Start	End	E-Value	Type
low complexity region	7	20	N/A	INTRINSIC
Blast:S_TKc	50	86	5e-10	BLAST
low complexity region	87	94	N/A	INTRINSIC
S_TKc	112	369	6.15e-106	SMART
S_TK_X	370	439	2.51e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000100036
AA Change: R184W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097614
Gene: ENSMUSG00000019970
AA Change: R184W

Domain	Start	End	E-Value	Type
Blast:S_TKc	22	58	5e-10	BLAST
low complexity region	59	66	N/A	INTRINSIC
S_TKc	84	341	6.15e-106	SMART
S_TK_X	342	411	2.51e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000120509
AA Change: R291W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114074
Gene: ENSMUSG00000019970
AA Change: R291W

Domain	Start	End	E-Value	Type
Blast:S_TKc	129	165	1e-9	BLAST
low complexity region	166	173	N/A	INTRINSIC
S_TKc	191	448	6.15e-106	SMART
S_TK_X	449	518	2.51e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000124350
AA Change: R171W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114691
Gene: ENSMUSG00000019970
AA Change: R171W

Domain	Start	End	E-Value	Type
Blast:S_TKc	9	45	2e-12	BLAST
low complexity region	46	53	N/A	INTRINSIC
Pfam:Pkinase	71	266	3.2e-62	PFAM
Pfam:Pkinase_Tyr	71	266	4.4e-34	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126560

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135195

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141218

Predicted Effect

probably benign
Transcript: ENSMUST00000142174

SMART Domains

Protein: ENSMUSP00000120882
Gene: ENSMUSG00000019970

Domain	Start	End	E-Value	Type
Blast:S_TKc	9	45	3e-14	BLAST
PDB:3HDN\|A	33	82	7e-18	PDB
SCOP:d1koba_	43	82	4e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000150089

SMART Domains

Protein: ENSMUSP00000115073
Gene: ENSMUSG00000019970

Domain	Start	End	E-Value	Type
Blast:S_TKc	22	58	4e-14	BLAST
PDB:3HDN\|A	46	89	3e-13	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000164659
AA Change: R171W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128873
Gene: ENSMUSG00000019970
AA Change: R171W

Domain	Start	End	E-Value	Type
Blast:S_TKc	9	45	5e-10	BLAST
low complexity region	46	53	N/A	INTRINSIC
S_TKc	71	328	6.15e-106	SMART
S_TK_X	329	398	2.51e-19	SMART

Meta Mutation Damage Score

0.7105

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

Strain: 3846797; 2445418
FUNCTION: This gene encodes a serine/threonine protein kinase that plays an important role in cellular stress response. This kinase activates certain potassium, sodium, and chloride channels, suggesting an involvement in the regulation of processes such as cell survival, neuronal excitability, and renal sodium excretion. This enzyme is activated by protein phosphorylation and degraded via the ubiquitination and proteasome pathway. Multiple transcript variants encoding different isoforms have been found for this gene. A pseudogene of this gene was identified on chromosome 12. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a disruption in this gene display an essentially normal phenotype. Sodium retention is compromised on a low salt diet. [provided by MGI curators]

Allele List at MGI

All alleles(143) : Targeted(6) Gene trapped(137)

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	T	C	1: 26,684,702	S466G	probably benign	Het
Aasdhppt	A	G	9: 4,309,322	S39P	probably damaging	Het
Aif1	G	A	17: 35,172,151	P44L	probably benign	Het
Anxa6	T	A	11: 55,011,735	I58F	probably damaging	Het
Ccdc30	T	A	4: 119,324,566	K582*	probably null	Het
Cebpz	A	G	17: 78,920,547		probably null	Het
Clstn3	T	A	6: 124,450,717	D473V	probably benign	Het
Cry1	A	T	10: 85,133,311	C550S	probably benign	Het
Dclk2	G	A	3: 86,920,035	P46S	probably damaging	Het
Dolk	G	T	2: 30,285,485	L183M	probably damaging	Het
Dpys	T	C	15: 39,828,090	T279A	possibly damaging	Het
Drd4	T	C	7: 141,293,941	Y140H	probably damaging	Het
Duox1	C	A	2: 122,333,730	C890*	probably null	Het
Epha2	T	A	4: 141,319,014	V508E	probably damaging	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Fahd1	A	T	17: 24,849,596	I169N	probably damaging	Het
Fgfr1	C	T	8: 25,570,893	S527F	probably damaging	Het
Flywch1	A	G	17: 23,763,026	V68A	probably benign	Het
Gm21834	A	T	17: 57,742,215	V2E	possibly damaging	Het
Gm7853	A	T	14: 36,089,664		noncoding transcript	Het
Igf2r	T	A	17: 12,715,943	H713L	probably benign	Het
Iqgap3	T	C	3: 88,116,031	V543A	probably benign	Het
Kcnq5	T	A	1: 21,479,371		probably null	Het
Lsm1	C	T	8: 25,785,684	P5S	possibly damaging	Het
March1	T	C	8: 66,121,790	M1T	probably null	Het
Myocd	T	C	11: 65,200,807	H103R	probably damaging	Het
Myom2	C	T	8: 15,063,927	T25I	probably damaging	Het
Nck1	T	C	9: 100,497,950	K83E	probably damaging	Het
Nid2	A	G	14: 19,789,761	D806G	probably benign	Het
Olfr639	T	A	7: 104,012,229	M158L	probably benign	Het
Onecut2	G	T	18: 64,341,197	R254L	probably damaging	Het
Plxna1	A	C	6: 89,324,316	L1534R	probably damaging	Het
Polb	C	A	8: 22,640,002	A185S	possibly damaging	Het
Pou3f3	T	C	1: 42,698,491	V449A	probably damaging	Het
Pskh1	C	T	8: 105,913,513	T275I	probably damaging	Het
Rab18	C	A	18: 6,788,516	A161D	probably damaging	Het
Rrp8	T	C	7: 105,734,804	R164G	probably benign	Het
Sacs	T	A	14: 61,207,759	I2418K	probably benign	Het
Scrn1	T	C	6: 54,525,646	E136G	probably benign	Het
Slitrk6	C	T	14: 110,751,955	A107T	probably damaging	Het
Tktl2	T	A	8: 66,513,143	F451Y	probably damaging	Het
Tnks1bp1	G	A	2: 85,058,915	V529M	probably benign	Het
Trps1	T	C	15: 50,661,346	K874E	probably damaging	Het
Ttll9	T	A	2: 152,983,127	D75E	probably benign	Het
Ttn	A	G	2: 76,766,024	Y20182H	probably damaging	Het
Ufc1	A	T	1: 171,289,248	C116S	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Zfp809	A	G	9: 22,238,680	K158E	possibly damaging	Het
Zfp81	A	G	17: 33,334,623	Y406H	probably damaging	Het

Other mutations in Sgk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02318:Sgk1	APN	10	21995541	missense	probably damaging	1.00
IGL02670:Sgk1	APN	10	21928546	missense	probably benign
IGL03220:Sgk1	APN	10	21997391	missense	probably null	1.00
R0010:Sgk1	UTSW	10	21997438	critical splice donor site	probably null
R0010:Sgk1	UTSW	10	21997438	critical splice donor site	probably null
R0467:Sgk1	UTSW	10	21996358	splice site	probably benign
R0479:Sgk1	UTSW	10	21996310	missense	probably benign	0.00
R0650:Sgk1	UTSW	10	21882657	missense	probably damaging	0.98
R0652:Sgk1	UTSW	10	21882657	missense	probably damaging	0.98
R0688:Sgk1	UTSW	10	21998160	missense	probably benign
R0990:Sgk1	UTSW	10	21997086	missense	probably damaging	1.00
R1769:Sgk1	UTSW	10	21997108	splice site	probably benign
R2009:Sgk1	UTSW	10	21996601	missense	probably damaging	1.00
R2218:Sgk1	UTSW	10	21996601	missense	probably damaging	1.00
R2909:Sgk1	UTSW	10	21994816	missense	probably benign
R2915:Sgk1	UTSW	10	21996601	missense	probably damaging	1.00
R3176:Sgk1	UTSW	10	21996601	missense	probably damaging	1.00
R3177:Sgk1	UTSW	10	21996601	missense	probably damaging	1.00
R3276:Sgk1	UTSW	10	21996601	missense	probably damaging	1.00
R3277:Sgk1	UTSW	10	21996601	missense	probably damaging	1.00
R3802:Sgk1	UTSW	10	21997412	missense	probably damaging	1.00
R5974:Sgk1	UTSW	10	21996249	missense	probably damaging	1.00
R6943:Sgk1	UTSW	10	21882694	missense	probably damaging	0.99
R7360:Sgk1	UTSW	10	21994073	missense	probably benign	0.01
R7425:Sgk1	UTSW	10	21994110	missense	probably damaging	0.97
R7665:Sgk1	UTSW	10	21996662	missense	probably damaging	1.00
R7973:Sgk1	UTSW	10	21994155	missense	probably benign	0.01
R8252:Sgk1	UTSW	10	21997399	missense	probably damaging	1.00
R8855:Sgk1	UTSW	10	21995827	missense	probably benign	0.12
R9199:Sgk1	UTSW	10	21882659	missense	probably damaging	0.99
R9492:Sgk1	UTSW	10	21998197	missense	probably damaging	0.97
R9670:Sgk1	UTSW	10	21992391	frame shift	probably null
R9683:Sgk1	UTSW	10	21992391	frame shift	probably null
R9723:Sgk1	UTSW	10	21996340	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTCCAGACCGCTGACAAGC -3'
(R):5'- TAGAGGTGACCAAAGTGCAC -3'

Sequencing Primer
(F):5'- CCTGGACTACATTAATGGTGGAG -3'
(R):5'- GGTGACCAAAGTGCACATAATATCTC -3'

Posted On

2014-10-30