Incidental Mutation 'R2314:Sgk1'
ID245423
Institutional Source Beutler Lab
Gene Symbol Sgk1
Ensembl Gene ENSMUSG00000019970
Gene Nameserum/glucocorticoid regulated kinase 1
SynonymsSgk, Sgk1
Accession Numbers

Ncbi RefSeq: NM_001161845.2, NM_001161847.2, NM_001161848.2, NM_001161849.2, NM_001161850.2, NM_011361.3; MGI:1340062

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2314 (G1)
Quality Score179
Status Not validated
Chromosome10
Chromosomal Location21882184-21999903 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21996601 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 171 (R171W)
Ref Sequence ENSEMBL: ENSMUSP00000128873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020145] [ENSMUST00000092673] [ENSMUST00000100036] [ENSMUST00000120509] [ENSMUST00000124350] [ENSMUST00000142174] [ENSMUST00000150089] [ENSMUST00000164659]
Predicted Effect probably damaging
Transcript: ENSMUST00000020145
AA Change: R198W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020145
Gene: ENSMUSG00000019970
AA Change: R198W

DomainStartEndE-ValueType
Blast:S_TKc 36 72 4e-10 BLAST
low complexity region 73 80 N/A INTRINSIC
S_TKc 98 355 6.15e-106 SMART
S_TK_X 356 425 2.51e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000092673
AA Change: R212W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090343
Gene: ENSMUSG00000019970
AA Change: R212W

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
Blast:S_TKc 50 86 5e-10 BLAST
low complexity region 87 94 N/A INTRINSIC
S_TKc 112 369 6.15e-106 SMART
S_TK_X 370 439 2.51e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100036
AA Change: R184W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097614
Gene: ENSMUSG00000019970
AA Change: R184W

DomainStartEndE-ValueType
Blast:S_TKc 22 58 5e-10 BLAST
low complexity region 59 66 N/A INTRINSIC
S_TKc 84 341 6.15e-106 SMART
S_TK_X 342 411 2.51e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120509
AA Change: R291W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114074
Gene: ENSMUSG00000019970
AA Change: R291W

DomainStartEndE-ValueType
Blast:S_TKc 129 165 1e-9 BLAST
low complexity region 166 173 N/A INTRINSIC
S_TKc 191 448 6.15e-106 SMART
S_TK_X 449 518 2.51e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124350
AA Change: R171W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114691
Gene: ENSMUSG00000019970
AA Change: R171W

DomainStartEndE-ValueType
Blast:S_TKc 9 45 2e-12 BLAST
low complexity region 46 53 N/A INTRINSIC
Pfam:Pkinase 71 266 3.2e-62 PFAM
Pfam:Pkinase_Tyr 71 266 4.4e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141218
Predicted Effect probably benign
Transcript: ENSMUST00000142174
SMART Domains Protein: ENSMUSP00000120882
Gene: ENSMUSG00000019970

DomainStartEndE-ValueType
Blast:S_TKc 9 45 3e-14 BLAST
PDB:3HDN|A 33 82 7e-18 PDB
SCOP:d1koba_ 43 82 4e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150089
SMART Domains Protein: ENSMUSP00000115073
Gene: ENSMUSG00000019970

DomainStartEndE-ValueType
Blast:S_TKc 22 58 4e-14 BLAST
PDB:3HDN|A 46 89 3e-13 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000164659
AA Change: R171W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128873
Gene: ENSMUSG00000019970
AA Change: R171W

DomainStartEndE-ValueType
Blast:S_TKc 9 45 5e-10 BLAST
low complexity region 46 53 N/A INTRINSIC
S_TKc 71 328 6.15e-106 SMART
S_TK_X 329 398 2.51e-19 SMART
Meta Mutation Damage Score 0.7105 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype Strain: 3846797; 2445418
FUNCTION: This gene encodes a serine/threonine protein kinase that plays an important role in cellular stress response. This kinase activates certain potassium, sodium, and chloride channels, suggesting an involvement in the regulation of processes such as cell survival, neuronal excitability, and renal sodium excretion. This enzyme is activated by protein phosphorylation and degraded via the ubiquitination and proteasome pathway. Multiple transcript variants encoding different isoforms have been found for this gene. A pseudogene of this gene was identified on chromosome 12. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a disruption in this gene display an essentially normal phenotype. Sodium retention is compromised on a low salt diet. [provided by MGI curators]
Allele List at MGI

All alleles(143) : Targeted(6) Gene trapped(137)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,684,702 S466G probably benign Het
Aasdhppt A G 9: 4,309,322 S39P probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Anxa6 T A 11: 55,011,735 I58F probably damaging Het
Ccdc30 T A 4: 119,324,566 K582* probably null Het
Cebpz A G 17: 78,920,547 probably null Het
Clstn3 T A 6: 124,450,717 D473V probably benign Het
Cry1 A T 10: 85,133,311 C550S probably benign Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dolk G T 2: 30,285,485 L183M probably damaging Het
Dpys T C 15: 39,828,090 T279A possibly damaging Het
Drd4 T C 7: 141,293,941 Y140H probably damaging Het
Duox1 C A 2: 122,333,730 C890* probably null Het
Epha2 T A 4: 141,319,014 V508E probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fahd1 A T 17: 24,849,596 I169N probably damaging Het
Fgfr1 C T 8: 25,570,893 S527F probably damaging Het
Flywch1 A G 17: 23,763,026 V68A probably benign Het
Gm21834 A T 17: 57,742,215 V2E possibly damaging Het
Gm7853 A T 14: 36,089,664 noncoding transcript Het
Igf2r T A 17: 12,715,943 H713L probably benign Het
Iqgap3 T C 3: 88,116,031 V543A probably benign Het
Kcnq5 T A 1: 21,479,371 probably null Het
Lsm1 C T 8: 25,785,684 P5S possibly damaging Het
March1 T C 8: 66,121,790 M1T probably null Het
Myocd T C 11: 65,200,807 H103R probably damaging Het
Myom2 C T 8: 15,063,927 T25I probably damaging Het
Nck1 T C 9: 100,497,950 K83E probably damaging Het
Nid2 A G 14: 19,789,761 D806G probably benign Het
Olfr639 T A 7: 104,012,229 M158L probably benign Het
Onecut2 G T 18: 64,341,197 R254L probably damaging Het
Plxna1 A C 6: 89,324,316 L1534R probably damaging Het
Polb C A 8: 22,640,002 A185S possibly damaging Het
Pou3f3 T C 1: 42,698,491 V449A probably damaging Het
Pskh1 C T 8: 105,913,513 T275I probably damaging Het
Rab18 C A 18: 6,788,516 A161D probably damaging Het
Rrp8 T C 7: 105,734,804 R164G probably benign Het
Sacs T A 14: 61,207,759 I2418K probably benign Het
Scrn1 T C 6: 54,525,646 E136G probably benign Het
Slitrk6 C T 14: 110,751,955 A107T probably damaging Het
Tktl2 T A 8: 66,513,143 F451Y probably damaging Het
Tnks1bp1 G A 2: 85,058,915 V529M probably benign Het
Trps1 T C 15: 50,661,346 K874E probably damaging Het
Ttll9 T A 2: 152,983,127 D75E probably benign Het
Ttn A G 2: 76,766,024 Y20182H probably damaging Het
Ufc1 A T 1: 171,289,248 C116S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zfp809 A G 9: 22,238,680 K158E possibly damaging Het
Zfp81 A G 17: 33,334,623 Y406H probably damaging Het
Other mutations in Sgk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Sgk1 APN 10 21995541 missense probably damaging 1.00
IGL02670:Sgk1 APN 10 21928546 missense probably benign
IGL03220:Sgk1 APN 10 21997391 missense probably null 1.00
R0010:Sgk1 UTSW 10 21997438 critical splice donor site probably null
R0010:Sgk1 UTSW 10 21997438 critical splice donor site probably null
R0467:Sgk1 UTSW 10 21996358 splice site probably benign
R0479:Sgk1 UTSW 10 21996310 missense probably benign 0.00
R0650:Sgk1 UTSW 10 21882657 missense probably damaging 0.98
R0652:Sgk1 UTSW 10 21882657 missense probably damaging 0.98
R0688:Sgk1 UTSW 10 21998160 missense probably benign
R0990:Sgk1 UTSW 10 21997086 missense probably damaging 1.00
R1769:Sgk1 UTSW 10 21997108 splice site probably benign
R2009:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R2218:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R2909:Sgk1 UTSW 10 21994816 missense probably benign
R2915:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R3176:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R3177:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R3276:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R3277:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R3802:Sgk1 UTSW 10 21997412 missense probably damaging 1.00
R5974:Sgk1 UTSW 10 21996249 missense probably damaging 1.00
R6943:Sgk1 UTSW 10 21882694 missense probably damaging 0.99
R7360:Sgk1 UTSW 10 21994073 missense probably benign 0.01
R7425:Sgk1 UTSW 10 21994110 missense probably damaging 0.97
R7665:Sgk1 UTSW 10 21996662 missense probably damaging 1.00
R7973:Sgk1 UTSW 10 21994155 missense probably benign 0.01
R8252:Sgk1 UTSW 10 21997399 missense probably damaging 1.00
R8855:Sgk1 UTSW 10 21995827 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- ATTCCAGACCGCTGACAAGC -3'
(R):5'- TAGAGGTGACCAAAGTGCAC -3'

Sequencing Primer
(F):5'- CCTGGACTACATTAATGGTGGAG -3'
(R):5'- GGTGACCAAAGTGCACATAATATCTC -3'
Posted On2014-10-30