Incidental Mutation 'R2314:Cry1'
ID245425
Institutional Source Beutler Lab
Gene Symbol Cry1
Ensembl Gene ENSMUSG00000020038
Gene Namecryptochrome 1 (photolyase-like)
SynonymsPhll1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2314 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location85131700-85185064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85133311 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 550 (C550S)
Ref Sequence ENSEMBL: ENSMUSP00000020227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020227]
PDB Structure Crystal Structure of Mouse Cryptochrome1 in Complex with Period2 [X-RAY DIFFRACTION]
Crystal structure of mouse Cryptochrome 1 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000020227
AA Change: C550S

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000020227
Gene: ENSMUSG00000020038
AA Change: C550S

DomainStartEndE-ValueType
Pfam:DNA_photolyase 5 168 1.4e-47 PFAM
Pfam:FAD_binding_7 213 486 6.9e-91 PFAM
internal_repeat_1 502 523 3.57e-8 PROSPERO
internal_repeat_1 521 543 3.57e-8 PROSPERO
low complexity region 544 555 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a flavin adenine dinucleotide-binding protein that is a key component of the circadian core oscillator complex, which regulates the circadian clock. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene have been associated with altered sleep patterns. The encoded protein is widely conserved across plants and animals. Loss of this gene results in a shortened circadian cycle in complete darkness. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a one-hour shorter circadian period under constant darkness and reduced expression of another circadian gene in the suprachiasmatic nucleus in response to acute light exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,684,702 S466G probably benign Het
Aasdhppt A G 9: 4,309,322 S39P probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Anxa6 T A 11: 55,011,735 I58F probably damaging Het
Ccdc30 T A 4: 119,324,566 K582* probably null Het
Cebpz A G 17: 78,920,547 probably null Het
Clstn3 T A 6: 124,450,717 D473V probably benign Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dolk G T 2: 30,285,485 L183M probably damaging Het
Dpys T C 15: 39,828,090 T279A possibly damaging Het
Drd4 T C 7: 141,293,941 Y140H probably damaging Het
Duox1 C A 2: 122,333,730 C890* probably null Het
Epha2 T A 4: 141,319,014 V508E probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fahd1 A T 17: 24,849,596 I169N probably damaging Het
Fgfr1 C T 8: 25,570,893 S527F probably damaging Het
Flywch1 A G 17: 23,763,026 V68A probably benign Het
Gm21834 A T 17: 57,742,215 V2E possibly damaging Het
Gm7853 A T 14: 36,089,664 noncoding transcript Het
Igf2r T A 17: 12,715,943 H713L probably benign Het
Iqgap3 T C 3: 88,116,031 V543A probably benign Het
Kcnq5 T A 1: 21,479,371 probably null Het
Lsm1 C T 8: 25,785,684 P5S possibly damaging Het
March1 T C 8: 66,121,790 M1T probably null Het
Myocd T C 11: 65,200,807 H103R probably damaging Het
Myom2 C T 8: 15,063,927 T25I probably damaging Het
Nck1 T C 9: 100,497,950 K83E probably damaging Het
Nid2 A G 14: 19,789,761 D806G probably benign Het
Olfr639 T A 7: 104,012,229 M158L probably benign Het
Onecut2 G T 18: 64,341,197 R254L probably damaging Het
Plxna1 A C 6: 89,324,316 L1534R probably damaging Het
Polb C A 8: 22,640,002 A185S possibly damaging Het
Pou3f3 T C 1: 42,698,491 V449A probably damaging Het
Pskh1 C T 8: 105,913,513 T275I probably damaging Het
Rab18 C A 18: 6,788,516 A161D probably damaging Het
Rrp8 T C 7: 105,734,804 R164G probably benign Het
Sacs T A 14: 61,207,759 I2418K probably benign Het
Scrn1 T C 6: 54,525,646 E136G probably benign Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Slitrk6 C T 14: 110,751,955 A107T probably damaging Het
Tktl2 T A 8: 66,513,143 F451Y probably damaging Het
Tnks1bp1 G A 2: 85,058,915 V529M probably benign Het
Trps1 T C 15: 50,661,346 K874E probably damaging Het
Ttll9 T A 2: 152,983,127 D75E probably benign Het
Ttn A G 2: 76,766,024 Y20182H probably damaging Het
Ufc1 A T 1: 171,289,248 C116S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zfp809 A G 9: 22,238,680 K158E possibly damaging Het
Zfp81 A G 17: 33,334,623 Y406H probably damaging Het
Other mutations in Cry1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Cry1 APN 10 85146834 missense probably benign 0.11
IGL00737:Cry1 APN 10 85143040 missense probably benign 0.02
IGL01349:Cry1 APN 10 85148739 missense probably benign 0.00
IGL01544:Cry1 APN 10 85146496 nonsense probably null
IGL01545:Cry1 APN 10 85184362 missense possibly damaging 0.94
IGL01767:Cry1 APN 10 85146474 missense probably damaging 1.00
IGL03392:Cry1 APN 10 85157129 missense possibly damaging 0.88
R0119:Cry1 UTSW 10 85133240 critical splice donor site probably null
R0605:Cry1 UTSW 10 85184359 missense probably damaging 0.96
R1618:Cry1 UTSW 10 85146454 missense probably damaging 1.00
R1955:Cry1 UTSW 10 85144178 missense probably benign 0.00
R2209:Cry1 UTSW 10 85146755 missense probably damaging 0.98
R2221:Cry1 UTSW 10 85143753 missense probably damaging 1.00
R2223:Cry1 UTSW 10 85143753 missense probably damaging 1.00
R3851:Cry1 UTSW 10 85146499 missense probably benign 0.15
R3872:Cry1 UTSW 10 85133160 critical splice acceptor site probably null
R3981:Cry1 UTSW 10 85146592 missense probably damaging 0.99
R4856:Cry1 UTSW 10 85148770 missense probably damaging 0.97
R5162:Cry1 UTSW 10 85133286 missense probably benign
R5404:Cry1 UTSW 10 85184419 missense probably damaging 1.00
R5449:Cry1 UTSW 10 85133135 missense probably benign 0.17
R5484:Cry1 UTSW 10 85146724 splice site probably null
R5599:Cry1 UTSW 10 85144250 missense probably benign 0.14
R5717:Cry1 UTSW 10 85146416 missense probably damaging 1.00
R7031:Cry1 UTSW 10 85148662 missense probably benign 0.00
R7371:Cry1 UTSW 10 85147919 missense probably benign 0.03
R7943:Cry1 UTSW 10 85143120 missense probably benign 0.03
R8022:Cry1 UTSW 10 85146402 missense probably damaging 0.97
R8290:Cry1 UTSW 10 85143113 nonsense probably null
R8805:Cry1 UTSW 10 85157105 missense probably benign 0.09
Z1176:Cry1 UTSW 10 85144197 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGGACGCTTCCCACTGCT -3'
(R):5'- TACATGTAAACACTGCACTCAAAGT -3'

Sequencing Primer
(F):5'- TTCCCACTGCTGAGGCC -3'
(R):5'- AGACAACCAGTGCTTTATTTTTGCC -3'
Posted On2014-10-30