Incidental Mutation 'R2314:Trps1'
ID245435
Institutional Source Beutler Lab
Gene Symbol Trps1
Ensembl Gene ENSMUSG00000038679
Gene Nametranscriptional repressor GATA binding 1
SynonymsD15Ertd586e
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2314 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location50654752-50890463 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50661346 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 874 (K874E)
Ref Sequence ENSEMBL: ENSMUSP00000139115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077935] [ENSMUST00000165201] [ENSMUST00000183757] [ENSMUST00000183997] [ENSMUST00000184458] [ENSMUST00000184885]
Predicted Effect probably damaging
Transcript: ENSMUST00000077935
AA Change: K1059E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077089
Gene: ENSMUSG00000038679
AA Change: K1059E

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
ZnF_C2H2 333 358 4.45e0 SMART
ZnF_C2H2 434 459 1.31e2 SMART
ZnF_C2H2 523 554 1.93e2 SMART
low complexity region 597 602 N/A INTRINSIC
ZnF_C2H2 614 637 8.67e-1 SMART
ZnF_C2H2 666 689 2.29e0 SMART
ZnF_C2H2 692 715 8.22e-2 SMART
low complexity region 766 779 N/A INTRINSIC
ZnF_GATA 890 940 3.95e-16 SMART
low complexity region 1050 1062 N/A INTRINSIC
ZnF_C2H2 1215 1237 4.34e0 SMART
ZnF_C2H2 1243 1267 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165201
AA Change: K1059E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129779
Gene: ENSMUSG00000038679
AA Change: K1059E

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
ZnF_C2H2 333 358 4.45e0 SMART
ZnF_C2H2 434 459 1.31e2 SMART
ZnF_C2H2 523 554 1.93e2 SMART
low complexity region 597 602 N/A INTRINSIC
ZnF_C2H2 614 637 8.67e-1 SMART
ZnF_C2H2 666 689 2.29e0 SMART
ZnF_C2H2 692 715 8.22e-2 SMART
low complexity region 766 779 N/A INTRINSIC
ZnF_GATA 890 940 3.95e-16 SMART
low complexity region 1050 1062 N/A INTRINSIC
ZnF_C2H2 1215 1237 4.34e0 SMART
ZnF_C2H2 1243 1267 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183757
AA Change: K1063E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139017
Gene: ENSMUSG00000038679
AA Change: K1063E

DomainStartEndE-ValueType
ZnF_C2H2 226 251 1.41e0 SMART
ZnF_C2H2 337 362 4.45e0 SMART
ZnF_C2H2 438 463 1.31e2 SMART
ZnF_C2H2 527 558 1.93e2 SMART
low complexity region 601 606 N/A INTRINSIC
ZnF_C2H2 618 641 8.67e-1 SMART
ZnF_C2H2 670 693 2.29e0 SMART
ZnF_C2H2 696 719 8.22e-2 SMART
low complexity region 770 783 N/A INTRINSIC
ZnF_GATA 894 944 3.95e-16 SMART
low complexity region 1054 1066 N/A INTRINSIC
ZnF_C2H2 1219 1241 4.34e0 SMART
ZnF_C2H2 1247 1271 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183997
AA Change: K874E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139115
Gene: ENSMUSG00000038679
AA Change: K874E

DomainStartEndE-ValueType
ZnF_C2H2 226 251 1.41e0 SMART
ZnF_C2H2 337 362 4.45e0 SMART
ZnF_C2H2 470 493 2.29e0 SMART
ZnF_C2H2 496 519 8.22e-2 SMART
low complexity region 570 583 N/A INTRINSIC
ZnF_GATA 705 755 3.95e-16 SMART
low complexity region 865 877 N/A INTRINSIC
ZnF_C2H2 1030 1052 4.34e0 SMART
ZnF_C2H2 1058 1082 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184458
AA Change: K772E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139063
Gene: ENSMUSG00000038679
AA Change: K772E

DomainStartEndE-ValueType
ZnF_C2H2 46 71 4.45e0 SMART
ZnF_C2H2 147 172 1.31e2 SMART
ZnF_C2H2 236 267 1.93e2 SMART
low complexity region 310 315 N/A INTRINSIC
ZnF_C2H2 327 350 8.67e-1 SMART
ZnF_C2H2 379 402 2.29e0 SMART
ZnF_C2H2 405 428 8.22e-2 SMART
low complexity region 479 492 N/A INTRINSIC
ZnF_GATA 603 653 3.95e-16 SMART
low complexity region 763 775 N/A INTRINSIC
ZnF_C2H2 928 950 4.34e0 SMART
ZnF_C2H2 956 980 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184885
AA Change: K813E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138905
Gene: ENSMUSG00000038679
AA Change: K813E

DomainStartEndE-ValueType
ZnF_C2H2 176 201 1.41e0 SMART
ZnF_C2H2 287 312 4.45e0 SMART
ZnF_C2H2 420 443 2.29e0 SMART
ZnF_C2H2 446 469 8.22e-2 SMART
low complexity region 520 533 N/A INTRINSIC
ZnF_GATA 644 694 3.95e-16 SMART
low complexity region 804 816 N/A INTRINSIC
ZnF_C2H2 969 991 4.34e0 SMART
ZnF_C2H2 997 1021 5.72e-1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that represses GATA-regulated genes and binds to a dynein light chain protein. Binding of the encoded protein to the dynein light chain protein affects binding to GATA consensus sequences and suppresses its transcriptional activity. Defects in this gene are a cause of tricho-rhino-phalangeal syndrome (TRPS) types I-III. [provided by RefSeq, Jul 2008]
PHENOTYPE: Newborn mice homozygous for a knock-out allele exhibit craniofacial and hair anomalies and die of respiratory failure due to thoracic spine and rib defects. Mice homozygous for a reporter allele show additional defects in chondrocyte proliferation and apoptosis as well as reduced nephron formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,684,702 S466G probably benign Het
Aasdhppt A G 9: 4,309,322 S39P probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Anxa6 T A 11: 55,011,735 I58F probably damaging Het
Ccdc30 T A 4: 119,324,566 K582* probably null Het
Cebpz A G 17: 78,920,547 probably null Het
Clstn3 T A 6: 124,450,717 D473V probably benign Het
Cry1 A T 10: 85,133,311 C550S probably benign Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dolk G T 2: 30,285,485 L183M probably damaging Het
Dpys T C 15: 39,828,090 T279A possibly damaging Het
Drd4 T C 7: 141,293,941 Y140H probably damaging Het
Duox1 C A 2: 122,333,730 C890* probably null Het
Epha2 T A 4: 141,319,014 V508E probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fahd1 A T 17: 24,849,596 I169N probably damaging Het
Fgfr1 C T 8: 25,570,893 S527F probably damaging Het
Flywch1 A G 17: 23,763,026 V68A probably benign Het
Gm21834 A T 17: 57,742,215 V2E possibly damaging Het
Gm7853 A T 14: 36,089,664 noncoding transcript Het
Igf2r T A 17: 12,715,943 H713L probably benign Het
Iqgap3 T C 3: 88,116,031 V543A probably benign Het
Kcnq5 T A 1: 21,479,371 probably null Het
Lsm1 C T 8: 25,785,684 P5S possibly damaging Het
March1 T C 8: 66,121,790 M1T probably null Het
Myocd T C 11: 65,200,807 H103R probably damaging Het
Myom2 C T 8: 15,063,927 T25I probably damaging Het
Nck1 T C 9: 100,497,950 K83E probably damaging Het
Nid2 A G 14: 19,789,761 D806G probably benign Het
Olfr639 T A 7: 104,012,229 M158L probably benign Het
Onecut2 G T 18: 64,341,197 R254L probably damaging Het
Plxna1 A C 6: 89,324,316 L1534R probably damaging Het
Polb C A 8: 22,640,002 A185S possibly damaging Het
Pou3f3 T C 1: 42,698,491 V449A probably damaging Het
Pskh1 C T 8: 105,913,513 T275I probably damaging Het
Rab18 C A 18: 6,788,516 A161D probably damaging Het
Rrp8 T C 7: 105,734,804 R164G probably benign Het
Sacs T A 14: 61,207,759 I2418K probably benign Het
Scrn1 T C 6: 54,525,646 E136G probably benign Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Slitrk6 C T 14: 110,751,955 A107T probably damaging Het
Tktl2 T A 8: 66,513,143 F451Y probably damaging Het
Tnks1bp1 G A 2: 85,058,915 V529M probably benign Het
Ttll9 T A 2: 152,983,127 D75E probably benign Het
Ttn A G 2: 76,766,024 Y20182H probably damaging Het
Ufc1 A T 1: 171,289,248 C116S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zfp809 A G 9: 22,238,680 K158E possibly damaging Het
Zfp81 A G 17: 33,334,623 Y406H probably damaging Het
Other mutations in Trps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Trps1 APN 15 50846870 missense probably benign 0.07
IGL00497:Trps1 APN 15 50661307 missense possibly damaging 0.91
IGL00558:Trps1 APN 15 50661085 missense probably damaging 1.00
IGL01325:Trps1 APN 15 50846814 missense probably benign 0.40
IGL02132:Trps1 APN 15 50822278 missense probably damaging 1.00
IGL02631:Trps1 APN 15 50846021 missense probably damaging 1.00
IGL02740:Trps1 APN 15 50846539 missense probably damaging 1.00
IGL02821:Trps1 APN 15 50660877 missense probably damaging 1.00
IGL03096:Trps1 APN 15 50846479 missense probably benign
F5770:Trps1 UTSW 15 50831577 missense probably damaging 1.00
R0050:Trps1 UTSW 15 50765525 missense probably benign 0.18
R0244:Trps1 UTSW 15 50664743 missense probably damaging 1.00
R0377:Trps1 UTSW 15 50831778 nonsense probably null
R0599:Trps1 UTSW 15 50831860 nonsense probably null
R0848:Trps1 UTSW 15 50661549 missense possibly damaging 0.54
R1744:Trps1 UTSW 15 50661213 missense probably damaging 1.00
R1830:Trps1 UTSW 15 50661136 missense probably damaging 0.99
R2083:Trps1 UTSW 15 50822305 missense probably damaging 1.00
R2167:Trps1 UTSW 15 50831730 missense possibly damaging 0.94
R2267:Trps1 UTSW 15 50822398 missense probably damaging 1.00
R3735:Trps1 UTSW 15 50846060 missense possibly damaging 0.94
R4133:Trps1 UTSW 15 50831387 missense probably damaging 1.00
R4223:Trps1 UTSW 15 50846648 missense probably benign
R4280:Trps1 UTSW 15 50846082 missense probably benign 0.00
R4566:Trps1 UTSW 15 50831678 missense probably damaging 1.00
R4810:Trps1 UTSW 15 50822296 missense probably benign 0.14
R4828:Trps1 UTSW 15 50660677 makesense probably null
R4838:Trps1 UTSW 15 50827316 missense probably benign 0.05
R4852:Trps1 UTSW 15 50846309 missense probably damaging 1.00
R5001:Trps1 UTSW 15 50661307 missense possibly damaging 0.91
R5311:Trps1 UTSW 15 50664760 missense probably damaging 1.00
R5463:Trps1 UTSW 15 50831890 nonsense probably null
R5677:Trps1 UTSW 15 50846108 missense probably damaging 1.00
R5691:Trps1 UTSW 15 50827304 missense probably benign
R6432:Trps1 UTSW 15 50831397 missense probably damaging 0.96
R6528:Trps1 UTSW 15 50822427 missense probably benign 0.01
R6594:Trps1 UTSW 15 50830955 missense probably damaging 0.99
R6827:Trps1 UTSW 15 50822563 missense probably benign 0.14
R6862:Trps1 UTSW 15 50831605 critical splice donor site probably null
R6912:Trps1 UTSW 15 50822298 missense possibly damaging 0.92
R7151:Trps1 UTSW 15 50822397 missense possibly damaging 0.95
R7846:Trps1 UTSW 15 50831877 missense probably damaging 0.99
R7857:Trps1 UTSW 15 50661005 missense probably damaging 1.00
V7580:Trps1 UTSW 15 50831577 missense probably damaging 1.00
V7581:Trps1 UTSW 15 50831577 missense probably damaging 1.00
V7583:Trps1 UTSW 15 50831577 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGTAGTGCGGATTCCCAG -3'
(R):5'- ATTCCACTTCCGAGCCTGAG -3'

Sequencing Primer
(F):5'- CCCAGGAACGGAGAGCTTATATTTAC -3'
(R):5'- TTCCGAGCCTGAGTAAATACG -3'
Posted On2014-10-30