Incidental Mutation 'R2314:Fahd1'
ID245439
Institutional Source Beutler Lab
Gene Symbol Fahd1
Ensembl Gene ENSMUSG00000045316
Gene Namefumarylacetoacetate hydrolase domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.396) question?
Stock #R2314 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24848896-24850302 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24849596 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 169 (I169N)
Ref Sequence ENSEMBL: ENSMUSP00000055827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024974] [ENSMUST00000049642] [ENSMUST00000118788] [ENSMUST00000130989] [ENSMUST00000149716] [ENSMUST00000154363] [ENSMUST00000164251] [ENSMUST00000169200]
Predicted Effect probably benign
Transcript: ENSMUST00000024974
SMART Domains Protein: ENSMUSP00000024974
Gene: ENSMUSG00000024158

DomainStartEndE-ValueType
Lactamase_B 11 173 2.61e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000049642
AA Change: I169N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055827
Gene: ENSMUSG00000045316
AA Change: I169N

DomainStartEndE-ValueType
Pfam:FAA_hydrolase 22 223 4e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118788
SMART Domains Protein: ENSMUSP00000113051
Gene: ENSMUSG00000024158

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
low complexity region 24 34 N/A INTRINSIC
Lactamase_B 60 222 2.61e-32 SMART
Pfam:HAGH_C 223 304 5.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130989
SMART Domains Protein: ENSMUSP00000120734
Gene: ENSMUSG00000024158

DomainStartEndE-ValueType
Lactamase_B 11 166 1.53e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149716
SMART Domains Protein: ENSMUSP00000114838
Gene: ENSMUSG00000024158

DomainStartEndE-ValueType
Lactamase_B 11 132 1.22e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154363
SMART Domains Protein: ENSMUSP00000114672
Gene: ENSMUSG00000024158

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
low complexity region 24 34 N/A INTRINSIC
Pfam:Lactamase_B 56 106 1.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164251
SMART Domains Protein: ENSMUSP00000129904
Gene: ENSMUSG00000024158

DomainStartEndE-ValueType
Lactamase_B 11 173 2.61e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169200
SMART Domains Protein: ENSMUSP00000126514
Gene: ENSMUSG00000024158

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
Lactamase_B 23 150 2.66e-1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,684,702 S466G probably benign Het
Aasdhppt A G 9: 4,309,322 S39P probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Anxa6 T A 11: 55,011,735 I58F probably damaging Het
Ccdc30 T A 4: 119,324,566 K582* probably null Het
Cebpz A G 17: 78,920,547 probably null Het
Clstn3 T A 6: 124,450,717 D473V probably benign Het
Cry1 A T 10: 85,133,311 C550S probably benign Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dolk G T 2: 30,285,485 L183M probably damaging Het
Dpys T C 15: 39,828,090 T279A possibly damaging Het
Drd4 T C 7: 141,293,941 Y140H probably damaging Het
Duox1 C A 2: 122,333,730 C890* probably null Het
Epha2 T A 4: 141,319,014 V508E probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fgfr1 C T 8: 25,570,893 S527F probably damaging Het
Flywch1 A G 17: 23,763,026 V68A probably benign Het
Gm21834 A T 17: 57,742,215 V2E possibly damaging Het
Gm7853 A T 14: 36,089,664 noncoding transcript Het
Igf2r T A 17: 12,715,943 H713L probably benign Het
Iqgap3 T C 3: 88,116,031 V543A probably benign Het
Kcnq5 T A 1: 21,479,371 probably null Het
Lsm1 C T 8: 25,785,684 P5S possibly damaging Het
March1 T C 8: 66,121,790 M1T probably null Het
Myocd T C 11: 65,200,807 H103R probably damaging Het
Myom2 C T 8: 15,063,927 T25I probably damaging Het
Nck1 T C 9: 100,497,950 K83E probably damaging Het
Nid2 A G 14: 19,789,761 D806G probably benign Het
Olfr639 T A 7: 104,012,229 M158L probably benign Het
Onecut2 G T 18: 64,341,197 R254L probably damaging Het
Plxna1 A C 6: 89,324,316 L1534R probably damaging Het
Polb C A 8: 22,640,002 A185S possibly damaging Het
Pou3f3 T C 1: 42,698,491 V449A probably damaging Het
Pskh1 C T 8: 105,913,513 T275I probably damaging Het
Rab18 C A 18: 6,788,516 A161D probably damaging Het
Rrp8 T C 7: 105,734,804 R164G probably benign Het
Sacs T A 14: 61,207,759 I2418K probably benign Het
Scrn1 T C 6: 54,525,646 E136G probably benign Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Slitrk6 C T 14: 110,751,955 A107T probably damaging Het
Tktl2 T A 8: 66,513,143 F451Y probably damaging Het
Tnks1bp1 G A 2: 85,058,915 V529M probably benign Het
Trps1 T C 15: 50,661,346 K874E probably damaging Het
Ttll9 T A 2: 152,983,127 D75E probably benign Het
Ttn A G 2: 76,766,024 Y20182H probably damaging Het
Ufc1 A T 1: 171,289,248 C116S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zfp809 A G 9: 22,238,680 K158E possibly damaging Het
Zfp81 A G 17: 33,334,623 Y406H probably damaging Het
Other mutations in Fahd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02057:Fahd1 APN 17 24849596 missense probably damaging 1.00
IGL02663:Fahd1 APN 17 24849504 missense probably damaging 1.00
IGL02677:Fahd1 APN 17 24849530 missense probably damaging 1.00
R0508:Fahd1 UTSW 17 24850001 missense probably benign 0.22
R1915:Fahd1 UTSW 17 24849648 missense possibly damaging 0.80
R2022:Fahd1 UTSW 17 24849840 missense probably benign 0.01
R5130:Fahd1 UTSW 17 24849759 missense probably damaging 0.98
R6746:Fahd1 UTSW 17 24849941 missense probably damaging 1.00
R8220:Fahd1 UTSW 17 24849890 missense probably damaging 0.98
R8546:Fahd1 UTSW 17 24850083 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- GTCCCAGGTCTTTTAGATCACG -3'
(R):5'- CATGACTGCCAGAGATGTGC -3'

Sequencing Primer
(F):5'- GGCACTCTACTCTCAGTATTCTG -3'
(R):5'- CTGCCAGAGATGTGCAGGAG -3'
Posted On2014-10-30