Incidental Mutation 'R2314:Aif1'
ID245441
Institutional Source Beutler Lab
Gene Symbol Aif1
Ensembl Gene ENSMUSG00000024397
Gene Nameallograft inflammatory factor 1
SynonymsD17H6S50E, Iba1, G1
Accession Numbers

Genbank: NM_019467; MGI: 1343098

Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R2314 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location35170991-35176068 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35172151 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 44 (P44L)
Ref Sequence ENSEMBL: ENSMUSP00000134107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025257] [ENSMUST00000172693] [ENSMUST00000173106] [ENSMUST00000173324]
Predicted Effect probably benign
Transcript: ENSMUST00000025257
AA Change: P44L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025257
Gene: ENSMUSG00000024397
AA Change: P44L

DomainStartEndE-ValueType
PDB:1WY9|A 1 147 1e-104 PDB
SCOP:d1mr8a_ 48 130 7e-10 SMART
Blast:EFh 49 77 1e-10 BLAST
Blast:EFh 85 113 1e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172679
Predicted Effect probably benign
Transcript: ENSMUST00000172693
AA Change: P44L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134214
Gene: ENSMUSG00000024397
AA Change: P44L

DomainStartEndE-ValueType
PDB:1WY9|A 1 147 1e-104 PDB
SCOP:d1mr8a_ 48 130 7e-10 SMART
Blast:EFh 49 77 1e-10 BLAST
Blast:EFh 85 113 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173106
AA Change: P44L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000134107
Gene: ENSMUSG00000024397
AA Change: P44L

DomainStartEndE-ValueType
PDB:1WY9|A 1 128 4e-47 PDB
Blast:EFh 98 122 4e-9 BLAST
SCOP:d1mr8a_ 98 128 7e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173281
Predicted Effect probably benign
Transcript: ENSMUST00000173324
AA Change: P44L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133709
Gene: ENSMUSG00000024397
AA Change: P44L

DomainStartEndE-ValueType
PDB:1WY9|A 1 147 1e-104 PDB
SCOP:d1mr8a_ 48 130 7e-10 SMART
Blast:EFh 49 77 1e-10 BLAST
Blast:EFh 85 113 1e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174044
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds actin and calcium. This gene is induced by cytokines and interferon and may promote macrophage activation and growth of vascular smooth muscle cells and T-lymphocytes. Polymorphisms in this gene may be associated with systemic sclerosis. Alternative splicing results in multiple transcript variants, but the full-length and coding nature of some of these variants is not certain. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased spleen weight, decreased platalet cell number and decreased susceptibility to induced arthritis. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,684,702 S466G probably benign Het
Aasdhppt A G 9: 4,309,322 S39P probably damaging Het
Anxa6 T A 11: 55,011,735 I58F probably damaging Het
Ccdc30 T A 4: 119,324,566 K582* probably null Het
Cebpz A G 17: 78,920,547 probably null Het
Clstn3 T A 6: 124,450,717 D473V probably benign Het
Cry1 A T 10: 85,133,311 C550S probably benign Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dolk G T 2: 30,285,485 L183M probably damaging Het
Dpys T C 15: 39,828,090 T279A possibly damaging Het
Drd4 T C 7: 141,293,941 Y140H probably damaging Het
Duox1 C A 2: 122,333,730 C890* probably null Het
Epha2 T A 4: 141,319,014 V508E probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fahd1 A T 17: 24,849,596 I169N probably damaging Het
Fgfr1 C T 8: 25,570,893 S527F probably damaging Het
Flywch1 A G 17: 23,763,026 V68A probably benign Het
Gm21834 A T 17: 57,742,215 V2E possibly damaging Het
Gm7853 A T 14: 36,089,664 noncoding transcript Het
Igf2r T A 17: 12,715,943 H713L probably benign Het
Iqgap3 T C 3: 88,116,031 V543A probably benign Het
Kcnq5 T A 1: 21,479,371 probably null Het
Lsm1 C T 8: 25,785,684 P5S possibly damaging Het
March1 T C 8: 66,121,790 M1T probably null Het
Myocd T C 11: 65,200,807 H103R probably damaging Het
Myom2 C T 8: 15,063,927 T25I probably damaging Het
Nck1 T C 9: 100,497,950 K83E probably damaging Het
Nid2 A G 14: 19,789,761 D806G probably benign Het
Olfr639 T A 7: 104,012,229 M158L probably benign Het
Onecut2 G T 18: 64,341,197 R254L probably damaging Het
Plxna1 A C 6: 89,324,316 L1534R probably damaging Het
Polb C A 8: 22,640,002 A185S possibly damaging Het
Pou3f3 T C 1: 42,698,491 V449A probably damaging Het
Pskh1 C T 8: 105,913,513 T275I probably damaging Het
Rab18 C A 18: 6,788,516 A161D probably damaging Het
Rrp8 T C 7: 105,734,804 R164G probably benign Het
Sacs T A 14: 61,207,759 I2418K probably benign Het
Scrn1 T C 6: 54,525,646 E136G probably benign Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Slitrk6 C T 14: 110,751,955 A107T probably damaging Het
Tktl2 T A 8: 66,513,143 F451Y probably damaging Het
Tnks1bp1 G A 2: 85,058,915 V529M probably benign Het
Trps1 T C 15: 50,661,346 K874E probably damaging Het
Ttll9 T A 2: 152,983,127 D75E probably benign Het
Ttn A G 2: 76,766,024 Y20182H probably damaging Het
Ufc1 A T 1: 171,289,248 C116S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zfp809 A G 9: 22,238,680 K158E possibly damaging Het
Zfp81 A G 17: 33,334,623 Y406H probably damaging Het
Other mutations in Aif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01717:Aif1 APN 17 35171555 missense probably damaging 1.00
IGL03279:Aif1 APN 17 35171547 nonsense probably null
N/A:Aif1 UTSW 17 35172520 missense possibly damaging 0.83
R0396:Aif1 UTSW 17 35171109 makesense probably null
R1062:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1063:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1064:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1105:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1122:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1154:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1286:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1447:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1678:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1689:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1750:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1911:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1974:Aif1 UTSW 17 35172151 missense probably benign 0.01
R2338:Aif1 UTSW 17 35172151 missense probably benign 0.01
R2341:Aif1 UTSW 17 35172151 missense probably benign 0.01
R2915:Aif1 UTSW 17 35172151 missense probably benign 0.01
R4953:Aif1 UTSW 17 35171098 splice site probably null
R5260:Aif1 UTSW 17 35171941 critical splice acceptor site probably null
R6786:Aif1 UTSW 17 35171496 missense probably damaging 1.00
R7503:Aif1 UTSW 17 35171573 missense probably damaging 1.00
R7534:Aif1 UTSW 17 35171414 missense possibly damaging 0.77
R7891:Aif1 UTSW 17 35172624 start gained probably benign
R8075:Aif1 UTSW 17 35171835 missense unknown
Y4338:Aif1 UTSW 17 35172151 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTTGGTGGCTGAGCAATGC -3'
(R):5'- GCTTTTGGACTGCTGAAGGC -3'

Sequencing Primer
(F):5'- CTGAGCAATGCCAGGGTAG -3'
(R):5'- CTGAAGGCCCAGCAGGAAG -3'
Posted On2014-10-30