Incidental Mutation 'R2314:Gm21834'
ID245442
Institutional Source Beutler Lab
Gene Symbol Gm21834
Ensembl Gene ENSMUSG00000095330
Gene Namepredicted gene, 21834
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock #R2314 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location57741767-57742219 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57742215 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 2 (V2E)
Ref Sequence ENSEMBL: ENSMUSP00000136534 (fasta)
Predicted Effect possibly damaging
Transcript: ENSMUST00000178907
AA Change: V2E

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,684,702 S466G probably benign Het
Aasdhppt A G 9: 4,309,322 S39P probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Anxa6 T A 11: 55,011,735 I58F probably damaging Het
Ccdc30 T A 4: 119,324,566 K582* probably null Het
Cebpz A G 17: 78,920,547 probably null Het
Clstn3 T A 6: 124,450,717 D473V probably benign Het
Cry1 A T 10: 85,133,311 C550S probably benign Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dolk G T 2: 30,285,485 L183M probably damaging Het
Dpys T C 15: 39,828,090 T279A possibly damaging Het
Drd4 T C 7: 141,293,941 Y140H probably damaging Het
Duox1 C A 2: 122,333,730 C890* probably null Het
Epha2 T A 4: 141,319,014 V508E probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fahd1 A T 17: 24,849,596 I169N probably damaging Het
Fgfr1 C T 8: 25,570,893 S527F probably damaging Het
Flywch1 A G 17: 23,763,026 V68A probably benign Het
Gm7853 A T 14: 36,089,664 noncoding transcript Het
Igf2r T A 17: 12,715,943 H713L probably benign Het
Iqgap3 T C 3: 88,116,031 V543A probably benign Het
Kcnq5 T A 1: 21,479,371 probably null Het
Lsm1 C T 8: 25,785,684 P5S possibly damaging Het
March1 T C 8: 66,121,790 M1T probably null Het
Myocd T C 11: 65,200,807 H103R probably damaging Het
Myom2 C T 8: 15,063,927 T25I probably damaging Het
Nck1 T C 9: 100,497,950 K83E probably damaging Het
Nid2 A G 14: 19,789,761 D806G probably benign Het
Olfr639 T A 7: 104,012,229 M158L probably benign Het
Onecut2 G T 18: 64,341,197 R254L probably damaging Het
Plxna1 A C 6: 89,324,316 L1534R probably damaging Het
Polb C A 8: 22,640,002 A185S possibly damaging Het
Pou3f3 T C 1: 42,698,491 V449A probably damaging Het
Pskh1 C T 8: 105,913,513 T275I probably damaging Het
Rab18 C A 18: 6,788,516 A161D probably damaging Het
Rrp8 T C 7: 105,734,804 R164G probably benign Het
Sacs T A 14: 61,207,759 I2418K probably benign Het
Scrn1 T C 6: 54,525,646 E136G probably benign Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Slitrk6 C T 14: 110,751,955 A107T probably damaging Het
Tktl2 T A 8: 66,513,143 F451Y probably damaging Het
Tnks1bp1 G A 2: 85,058,915 V529M probably benign Het
Trps1 T C 15: 50,661,346 K874E probably damaging Het
Ttll9 T A 2: 152,983,127 D75E probably benign Het
Ttn A G 2: 76,766,024 Y20182H probably damaging Het
Ufc1 A T 1: 171,289,248 C116S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zfp809 A G 9: 22,238,680 K158E possibly damaging Het
Zfp81 A G 17: 33,334,623 Y406H probably damaging Het
Other mutations in Gm21834
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03286:Gm21834 APN 17 57741927 missense possibly damaging 0.46
R0440:Gm21834 UTSW 17 57742126 missense possibly damaging 0.66
R0624:Gm21834 UTSW 17 57742020 missense possibly damaging 0.82
R1542:Gm21834 UTSW 17 57741951 missense possibly damaging 0.66
R2051:Gm21834 UTSW 17 57741768 missense possibly damaging 0.46
R4591:Gm21834 UTSW 17 57741885 missense possibly damaging 0.66
Z1088:Gm21834 UTSW 17 57742121 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- ATCTGCCCCGATAATCTGTCTG -3'
(R):5'- CCAATATCCTGTAGGTCCCCAG -3'

Sequencing Primer
(F):5'- TGCCCCGATAATCTGTCTGAATACAG -3'
(R):5'- AGTTCCTGGGATGTACTCTCCG -3'
Posted On2014-10-30