Incidental Mutation 'R2314:Rab18'
ID245444
Institutional Source Beutler Lab
Gene Symbol Rab18
Ensembl Gene ENSMUSG00000073639
Gene NameRAB18, member RAS oncogene family
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.836) question?
Stock #R2314 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location6765205-6790231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 6788516 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 161 (A161D)
Ref Sequence ENSEMBL: ENSMUSP00000095285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097680]
Predicted Effect probably damaging
Transcript: ENSMUST00000097680
AA Change: A161D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095285
Gene: ENSMUSG00000073639
AA Change: A161D

DomainStartEndE-ValueType
RAB 9 172 1.83e-104 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Ras-related small GTPases, which regulate membrane trafficking in organelles and transport vesicles. This protein is expressed predominantly in lipid droplets, organelles that store neutral lipids, and is proposed to play a role in lipolysis and lipogenesis. In humans mutations in this gene are associated with Warburg micro syndrome type 3. A pseudogene of this gene is located on chromosome X. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice show partial perinatal lethality and abnormal eye development, and develop nuclear cataracts, atonic pupils, progressive limb weakness, disruption of neuronal cytoskeleton, and accumulation of neurofilament and microtubule proteins in synaptic terminals. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,684,702 S466G probably benign Het
Aasdhppt A G 9: 4,309,322 S39P probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Anxa6 T A 11: 55,011,735 I58F probably damaging Het
Ccdc30 T A 4: 119,324,566 K582* probably null Het
Cebpz A G 17: 78,920,547 probably null Het
Clstn3 T A 6: 124,450,717 D473V probably benign Het
Cry1 A T 10: 85,133,311 C550S probably benign Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dolk G T 2: 30,285,485 L183M probably damaging Het
Dpys T C 15: 39,828,090 T279A possibly damaging Het
Drd4 T C 7: 141,293,941 Y140H probably damaging Het
Duox1 C A 2: 122,333,730 C890* probably null Het
Epha2 T A 4: 141,319,014 V508E probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fahd1 A T 17: 24,849,596 I169N probably damaging Het
Fgfr1 C T 8: 25,570,893 S527F probably damaging Het
Flywch1 A G 17: 23,763,026 V68A probably benign Het
Gm21834 A T 17: 57,742,215 V2E possibly damaging Het
Gm7853 A T 14: 36,089,664 noncoding transcript Het
Igf2r T A 17: 12,715,943 H713L probably benign Het
Iqgap3 T C 3: 88,116,031 V543A probably benign Het
Kcnq5 T A 1: 21,479,371 probably null Het
Lsm1 C T 8: 25,785,684 P5S possibly damaging Het
March1 T C 8: 66,121,790 M1T probably null Het
Myocd T C 11: 65,200,807 H103R probably damaging Het
Myom2 C T 8: 15,063,927 T25I probably damaging Het
Nck1 T C 9: 100,497,950 K83E probably damaging Het
Nid2 A G 14: 19,789,761 D806G probably benign Het
Olfr639 T A 7: 104,012,229 M158L probably benign Het
Onecut2 G T 18: 64,341,197 R254L probably damaging Het
Plxna1 A C 6: 89,324,316 L1534R probably damaging Het
Polb C A 8: 22,640,002 A185S possibly damaging Het
Pou3f3 T C 1: 42,698,491 V449A probably damaging Het
Pskh1 C T 8: 105,913,513 T275I probably damaging Het
Rrp8 T C 7: 105,734,804 R164G probably benign Het
Sacs T A 14: 61,207,759 I2418K probably benign Het
Scrn1 T C 6: 54,525,646 E136G probably benign Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Slitrk6 C T 14: 110,751,955 A107T probably damaging Het
Tktl2 T A 8: 66,513,143 F451Y probably damaging Het
Tnks1bp1 G A 2: 85,058,915 V529M probably benign Het
Trps1 T C 15: 50,661,346 K874E probably damaging Het
Ttll9 T A 2: 152,983,127 D75E probably benign Het
Ttn A G 2: 76,766,024 Y20182H probably damaging Het
Ufc1 A T 1: 171,289,248 C116S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zfp809 A G 9: 22,238,680 K158E possibly damaging Het
Zfp81 A G 17: 33,334,623 Y406H probably damaging Het
Other mutations in Rab18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02793:Rab18 APN 18 6788474 splice site probably benign
R2018:Rab18 UTSW 18 6770113 splice site probably null
R2248:Rab18 UTSW 18 6788629 missense probably damaging 1.00
R3976:Rab18 UTSW 18 6778529 missense probably benign 0.00
R6240:Rab18 UTSW 18 6784635 missense probably benign 0.23
R7081:Rab18 UTSW 18 6778529 missense probably benign 0.00
R7652:Rab18 UTSW 18 6783123 missense possibly damaging 0.95
R8696:Rab18 UTSW 18 6788635 missense probably damaging 1.00
X0026:Rab18 UTSW 18 6788615 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGCAGAGTTGAAGTAGTTCTC -3'
(R):5'- CTGCAAGGTCCCTAATAGCAG -3'

Sequencing Primer
(F):5'- GGGAGTGGAGGAAATTTACTAATTTG -3'
(R):5'- CTGCAAGGTCCCTAATAGCAGTTAAG -3'
Posted On2014-10-30