Incidental Mutation 'R2315:Sez6l'
ID245452
Institutional Source Beutler Lab
Gene Symbol Sez6l
Ensembl Gene ENSMUSG00000058153
Gene Nameseizure related 6 homolog like
SynonymsAcig1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2315 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location112419151-112577185 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112464597 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 493 (S493P)
Ref Sequence ENSEMBL: ENSMUSP00000148791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075387] [ENSMUST00000079491] [ENSMUST00000197425] [ENSMUST00000212480] [ENSMUST00000212758]
Predicted Effect probably benign
Transcript: ENSMUST00000075387
AA Change: S493P

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000074847
Gene: ENSMUSG00000058153
AA Change: S493P

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
CUB 221 329 3.62e-8 SMART
CCP 333 388 1.01e-11 SMART
CUB 392 502 3.75e-15 SMART
CCP 507 564 1.41e-10 SMART
CUB 568 679 4.87e-23 SMART
CCP 685 740 4.95e-15 SMART
CCP 746 805 3.07e-11 SMART
CCP 813 870 8.04e-15 SMART
low complexity region 880 891 N/A INTRINSIC
transmembrane domain 895 917 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079491
AA Change: S493P

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000078454
Gene: ENSMUSG00000058153
AA Change: S493P

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
CUB 221 329 3.62e-8 SMART
CCP 333 388 1.01e-11 SMART
CUB 392 502 3.75e-15 SMART
CCP 507 564 1.41e-10 SMART
CUB 568 679 4.87e-23 SMART
CCP 685 740 4.95e-15 SMART
CCP 746 805 3.07e-11 SMART
CCP 813 870 8.04e-15 SMART
low complexity region 878 892 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197425
AA Change: S493P

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000143395
Gene: ENSMUSG00000058153
AA Change: S493P

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
CUB 221 329 3.62e-8 SMART
CCP 333 388 1.01e-11 SMART
CUB 392 502 3.75e-15 SMART
CCP 507 564 1.41e-10 SMART
CUB 568 679 4.87e-23 SMART
CCP 685 740 4.95e-15 SMART
CCP 746 805 3.07e-11 SMART
low complexity region 815 826 N/A INTRINSIC
transmembrane domain 830 852 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000200575
AA Change: S307P
Predicted Effect probably benign
Transcript: ENSMUST00000212480
AA Change: S493P

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000212758
AA Change: S493P

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display slightly impaired coordination in the rotarod task. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cnot1 C T 8: 95,749,062 G995R probably damaging Het
Cntn2 T C 1: 132,522,997 T547A probably benign Het
Ddx20 A G 3: 105,678,699 Y777H probably damaging Het
Fbxo32 T C 15: 58,208,035 N50S probably benign Het
Fsip2 G C 2: 82,975,093 M585I probably benign Het
Gm13941 A G 2: 111,104,817 S23P unknown Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Hoxa2 A G 6: 52,162,891 probably benign Het
Hydin A G 8: 110,398,044 I562V probably benign Het
Kif20b T A 19: 34,931,599 L179M probably damaging Het
Myl3 T C 9: 110,766,741 L102P probably damaging Het
Pag1 C T 3: 9,699,764 V110I probably damaging Het
Scube2 A G 7: 109,804,701 F861L probably damaging Het
Serpina3n A T 12: 104,412,368 I316F possibly damaging Het
Sult1c2 T A 17: 53,838,493 T52S possibly damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Vmn2r17 A C 5: 109,428,031 D256A probably damaging Het
Xylb T C 9: 119,359,269 F47S probably benign Het
Zim1 T C 7: 6,677,068 D532G possibly damaging Het
Other mutations in Sez6l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Sez6l APN 5 112424645 missense probably damaging 1.00
IGL00494:Sez6l APN 5 112463003 missense probably damaging 1.00
IGL00693:Sez6l APN 5 112422013 missense probably damaging 1.00
IGL01146:Sez6l APN 5 112428409 missense probably damaging 1.00
IGL01382:Sez6l APN 5 112425621 missense probably benign 0.00
IGL01393:Sez6l APN 5 112438395 splice site probably benign
IGL01961:Sez6l APN 5 112471731 missense probably damaging 1.00
IGL02101:Sez6l APN 5 112472746 missense probably damaging 1.00
IGL02104:Sez6l APN 5 112426764 intron probably benign
IGL02316:Sez6l APN 5 112462962 missense probably damaging 1.00
IGL02965:Sez6l APN 5 112475574 missense probably damaging 0.99
IGL03102:Sez6l APN 5 112475403 missense probably benign 0.02
IGL03112:Sez6l APN 5 112473467 missense probably damaging 1.00
IGL03180:Sez6l APN 5 112436285 missense probably damaging 1.00
R0245:Sez6l UTSW 5 112475566 missense probably benign
R0662:Sez6l UTSW 5 112473422 missense probably damaging 1.00
R1227:Sez6l UTSW 5 112473464 missense probably damaging 1.00
R1605:Sez6l UTSW 5 112475049 missense probably damaging 1.00
R1873:Sez6l UTSW 5 112473410 splice site probably benign
R1878:Sez6l UTSW 5 112475223 missense probably damaging 0.98
R1892:Sez6l UTSW 5 112472799 missense probably damaging 1.00
R1961:Sez6l UTSW 5 112424615 splice site probably benign
R2038:Sez6l UTSW 5 112472752 missense possibly damaging 0.81
R2212:Sez6l UTSW 5 112475361 missense possibly damaging 0.76
R2343:Sez6l UTSW 5 112464731 missense probably damaging 1.00
R3412:Sez6l UTSW 5 112475361 missense possibly damaging 0.76
R3413:Sez6l UTSW 5 112475361 missense possibly damaging 0.76
R3423:Sez6l UTSW 5 112426749 missense probably damaging 0.99
R3425:Sez6l UTSW 5 112426749 missense probably damaging 0.99
R4081:Sez6l UTSW 5 112461166 missense probably benign 0.01
R4574:Sez6l UTSW 5 112428478 missense probably damaging 1.00
R5792:Sez6l UTSW 5 112422024 nonsense probably null
R5864:Sez6l UTSW 5 112438400 critical splice donor site probably null
R6236:Sez6l UTSW 5 112475244 missense possibly damaging 0.86
R6274:Sez6l UTSW 5 112475365 nonsense probably null
R6466:Sez6l UTSW 5 112461141 splice site probably null
R6574:Sez6l UTSW 5 112576826 missense possibly damaging 0.89
R7008:Sez6l UTSW 5 112464695 missense probably damaging 1.00
R7241:Sez6l UTSW 5 112473480 missense probably benign
R7329:Sez6l UTSW 5 112440907 missense probably damaging 0.99
R7335:Sez6l UTSW 5 112576812 synonymous probably null
R7502:Sez6l UTSW 5 112475481 missense possibly damaging 0.89
R7870:Sez6l UTSW 5 112438581 missense probably damaging 1.00
R7953:Sez6l UTSW 5 112438581 missense probably damaging 1.00
X0052:Sez6l UTSW 5 112472901 missense possibly damaging 0.75
Z1088:Sez6l UTSW 5 112440915 missense probably damaging 1.00
Z1177:Sez6l UTSW 5 112576932 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCAGGCACCAGTATAAGAACTGC -3'
(R):5'- CCTGCAAGACATGTCAGCATCC -3'

Sequencing Primer
(F):5'- CACCAGTATAAGAACTGCTTAGAAG -3'
(R):5'- AGACATGTCAGCATCCCTCTG -3'
Posted On2014-10-30