Incidental Mutation 'R2315:Gpat4'
ID245456
Institutional Source Beutler Lab
Gene Symbol Gpat4
Ensembl Gene ENSMUSG00000031545
Gene Nameglycerol-3-phosphate acyltransferase 4
SynonymsAgpat6
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.403) question?
Stock #R2315 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location23171265-23208346 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23180155 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 286 (P286L)
Ref Sequence ENSEMBL: ENSMUSP00000127325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167004] [ENSMUST00000209507]
Predicted Effect probably damaging
Transcript: ENSMUST00000167004
AA Change: P286L

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127325
Gene: ENSMUSG00000031545
AA Change: P286L

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 156 175 N/A INTRINSIC
transmembrane domain 180 202 N/A INTRINSIC
PlsC 242 353 9.31e-24 SMART
Blast:PlsC 368 413 7e-18 BLAST
low complexity region 414 425 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211260
Meta Mutation Damage Score 0.9423 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Lysophosphatidic acid acyltransferases (EC 2.3.1.51) catalyze the conversion of lysophosphatidic acid (LPA) to phosphatidic acid (PA). LPA and PA are involved in signal transduction and lipid biosynthesis.[supplied by OMIM, Apr 2004]
PHENOTYPE: Nursing mothers homozygous for a gene trap allele display underdeveloped mammary glands that are depleted in intracellular fat droplets and lack the ability to produce diacylglycerol- and triacylglycerol-rich milk; pups nursed by mutant mothers die neonatally unless transferred to foster mothers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cnot1 C T 8: 95,749,062 G995R probably damaging Het
Cntn2 T C 1: 132,522,997 T547A probably benign Het
Ddx20 A G 3: 105,678,699 Y777H probably damaging Het
Fbxo32 T C 15: 58,208,035 N50S probably benign Het
Fsip2 G C 2: 82,975,093 M585I probably benign Het
Gm13941 A G 2: 111,104,817 S23P unknown Het
Hoxa2 A G 6: 52,162,891 probably benign Het
Hydin A G 8: 110,398,044 I562V probably benign Het
Kif20b T A 19: 34,931,599 L179M probably damaging Het
Myl3 T C 9: 110,766,741 L102P probably damaging Het
Pag1 C T 3: 9,699,764 V110I probably damaging Het
Scube2 A G 7: 109,804,701 F861L probably damaging Het
Serpina3n A T 12: 104,412,368 I316F possibly damaging Het
Sez6l A G 5: 112,464,597 S493P probably benign Het
Sult1c2 T A 17: 53,838,493 T52S possibly damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Vmn2r17 A C 5: 109,428,031 D256A probably damaging Het
Xylb T C 9: 119,359,269 F47S probably benign Het
Zim1 T C 7: 6,677,068 D532G possibly damaging Het
Other mutations in Gpat4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Gpat4 APN 8 23182775 missense probably damaging 0.97
IGL01660:Gpat4 APN 8 23175338 critical splice donor site probably null
IGL01688:Gpat4 APN 8 23181845 missense probably benign 0.03
IGL02749:Gpat4 APN 8 23180870 missense probably damaging 1.00
R0076:Gpat4 UTSW 8 23190705 splice site probably benign
R0362:Gpat4 UTSW 8 23180933 missense probably benign 0.05
R0961:Gpat4 UTSW 8 23180911 missense probably damaging 0.96
R1876:Gpat4 UTSW 8 23179470 missense possibly damaging 0.82
R1959:Gpat4 UTSW 8 23182936 missense possibly damaging 0.81
R2217:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R2313:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R2969:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3110:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3112:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3774:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3775:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3826:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3828:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3829:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3830:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3943:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3944:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R4384:Gpat4 UTSW 8 23174586 missense probably benign 0.05
R4685:Gpat4 UTSW 8 23182849 utr 5 prime probably benign
R5120:Gpat4 UTSW 8 23180202 missense possibly damaging 0.77
R5199:Gpat4 UTSW 8 23182696 missense possibly damaging 0.46
R5491:Gpat4 UTSW 8 23180664 missense probably benign 0.38
X0062:Gpat4 UTSW 8 23190711 splice site probably null
X0064:Gpat4 UTSW 8 23175394 missense probably damaging 1.00
Z1176:Gpat4 UTSW 8 23179798 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGATGGACCATTTGCCCCAC -3'
(R):5'- CTCACAACCAGGGGTCTAAAGAG -3'

Sequencing Primer
(F):5'- CACAGTTCCAAATTTGTTTATTGGG -3'
(R):5'- GTGGAACAGAGACTGGGGTATTTG -3'
Posted On2014-10-30