Incidental Mutation 'R2315:Myl3'
ID245461
Institutional Source Beutler Lab
Gene Symbol Myl3
Ensembl Gene ENSMUSG00000059741
Gene Namemyosin, light polypeptide 3
SynonymsMLC1v, alkali, slow skeletal, MLC1s, Mylc, ventricular
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.292) question?
Stock #R2315 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location110741861-110769798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110766741 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 102 (L102P)
Ref Sequence ENSEMBL: ENSMUSP00000142530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079784] [ENSMUST00000124267] [ENSMUST00000136695] [ENSMUST00000200011]
Predicted Effect probably damaging
Transcript: ENSMUST00000079784
AA Change: L102P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078715
Gene: ENSMUSG00000059741
AA Change: L102P

DomainStartEndE-ValueType
low complexity region 2 45 N/A INTRINSIC
internal_repeat_1 61 124 1.28e-5 PROSPERO
internal_repeat_1 140 198 1.28e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000124267
AA Change: L25P

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142424
Gene: ENSMUSG00000059741
AA Change: L25P

DomainStartEndE-ValueType
SCOP:d1ggwa_ 1 127 2e-23 SMART
PDB:1W7J|B 2 126 3e-68 PDB
Blast:EFh 64 92 5e-12 BLAST
Blast:EFh 99 126 2e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000136695
AA Change: L25P

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142791
Gene: ENSMUSG00000059741
AA Change: L25P

DomainStartEndE-ValueType
SCOP:d1ggwa_ 1 127 2e-23 SMART
PDB:1W7J|B 2 126 3e-68 PDB
Blast:EFh 64 92 5e-12 BLAST
Blast:EFh 99 126 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153142
Predicted Effect probably damaging
Transcript: ENSMUST00000200011
AA Change: L102P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142530
Gene: ENSMUSG00000059741
AA Change: L102P

DomainStartEndE-ValueType
low complexity region 2 45 N/A INTRINSIC
Pfam:EF-hand_6 62 93 4.7e-3 PFAM
internal_repeat_1 140 182 5.24e-5 PROSPERO
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MYL3 encodes myosin light chain 3, an alkali light chain also referred to in the literature as both the ventricular isoform and the slow skeletal muscle isoform. Mutations in MYL3 have been identified as a cause of mid-left ventricular chamber type hypertrophic cardiomyopathy. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cnot1 C T 8: 95,749,062 G995R probably damaging Het
Cntn2 T C 1: 132,522,997 T547A probably benign Het
Ddx20 A G 3: 105,678,699 Y777H probably damaging Het
Fbxo32 T C 15: 58,208,035 N50S probably benign Het
Fsip2 G C 2: 82,975,093 M585I probably benign Het
Gm13941 A G 2: 111,104,817 S23P unknown Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Hoxa2 A G 6: 52,162,891 probably benign Het
Hydin A G 8: 110,398,044 I562V probably benign Het
Kif20b T A 19: 34,931,599 L179M probably damaging Het
Pag1 C T 3: 9,699,764 V110I probably damaging Het
Scube2 A G 7: 109,804,701 F861L probably damaging Het
Serpina3n A T 12: 104,412,368 I316F possibly damaging Het
Sez6l A G 5: 112,464,597 S493P probably benign Het
Sult1c2 T A 17: 53,838,493 T52S possibly damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Vmn2r17 A C 5: 109,428,031 D256A probably damaging Het
Xylb T C 9: 119,359,269 F47S probably benign Het
Zim1 T C 7: 6,677,068 D532G possibly damaging Het
Other mutations in Myl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Myl3 APN 9 110766489 missense possibly damaging 0.95
IGL01292:Myl3 APN 9 110767977 missense probably damaging 1.00
IGL02814:Myl3 APN 9 110767991 nonsense probably null
R0009:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0010:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0015:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0040:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0045:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0045:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0080:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0081:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0095:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0194:Myl3 UTSW 9 110769121 missense probably benign 0.00
R1938:Myl3 UTSW 9 110766734 missense probably damaging 1.00
R2230:Myl3 UTSW 9 110767911 missense probably damaging 1.00
R2231:Myl3 UTSW 9 110767911 missense probably damaging 1.00
R3884:Myl3 UTSW 9 110767959 missense probably damaging 1.00
R5473:Myl3 UTSW 9 110767958 missense probably damaging 1.00
R7059:Myl3 UTSW 9 110742037 splice site probably benign
Predicted Primers PCR Primer
(F):5'- TTGAAGGTGAGCAGGATCCTG -3'
(R):5'- TGTCTGGTAGCCAAAGCCAC -3'

Sequencing Primer
(F):5'- ACCAGGGGTCTCTGATCCAATAG -3'
(R):5'- TGGTAGCCAAAGCCACATCCG -3'
Posted On2014-10-30