Incidental Mutation 'R2315:Fbxo32'
ID245466
Institutional Source Beutler Lab
Gene Symbol Fbxo32
Ensembl Gene ENSMUSG00000022358
Gene NameF-box protein 32
Synonyms4833442G10Rik, atrogin-1, MAFbx, ATROGIN1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2315 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location58175879-58214932 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58208035 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 50 (N50S)
Ref Sequence ENSEMBL: ENSMUSP00000022986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022986]
Predicted Effect probably benign
Transcript: ENSMUST00000022986
AA Change: N50S

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000022986
Gene: ENSMUSG00000022358
AA Change: N50S

DomainStartEndE-ValueType
Blast:FBOX 228 269 6e-16 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and contains an F-box domain. This protein is highly expressed during muscle atrophy, whereas mice deficient in this gene were found to be resistant to atrophy. This protein is thus a potential drug target for the treatment of muscle atrophy. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2011]
PHENOTYPE: A targeted homozygous mutation in this gene results in resistance to skeletal muscle atrophy in response to nerve injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cnot1 C T 8: 95,749,062 G995R probably damaging Het
Cntn2 T C 1: 132,522,997 T547A probably benign Het
Ddx20 A G 3: 105,678,699 Y777H probably damaging Het
Fsip2 G C 2: 82,975,093 M585I probably benign Het
Gm13941 A G 2: 111,104,817 S23P unknown Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Hoxa2 A G 6: 52,162,891 probably benign Het
Hydin A G 8: 110,398,044 I562V probably benign Het
Kif20b T A 19: 34,931,599 L179M probably damaging Het
Myl3 T C 9: 110,766,741 L102P probably damaging Het
Pag1 C T 3: 9,699,764 V110I probably damaging Het
Scube2 A G 7: 109,804,701 F861L probably damaging Het
Serpina3n A T 12: 104,412,368 I316F possibly damaging Het
Sez6l A G 5: 112,464,597 S493P probably benign Het
Sult1c2 T A 17: 53,838,493 T52S possibly damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Vmn2r17 A C 5: 109,428,031 D256A probably damaging Het
Xylb T C 9: 119,359,269 F47S probably benign Het
Zim1 T C 7: 6,677,068 D532G possibly damaging Het
Other mutations in Fbxo32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01584:Fbxo32 APN 15 58184236 missense probably damaging 0.98
IGL02371:Fbxo32 APN 15 58181464 utr 3 prime probably benign
IGL02721:Fbxo32 APN 15 58182962 missense possibly damaging 0.85
R0277:Fbxo32 UTSW 15 58184209 missense probably damaging 1.00
R0323:Fbxo32 UTSW 15 58184209 missense probably damaging 1.00
R1661:Fbxo32 UTSW 15 58191469 missense probably damaging 1.00
R2321:Fbxo32 UTSW 15 58191293 missense possibly damaging 0.52
R2849:Fbxo32 UTSW 15 58207972 missense probably benign
R4233:Fbxo32 UTSW 15 58192333 missense possibly damaging 0.81
R4569:Fbxo32 UTSW 15 58181477 missense probably damaging 0.99
R6856:Fbxo32 UTSW 15 58214641 start gained probably benign
R7747:Fbxo32 UTSW 15 58191361 missense probably damaging 1.00
R7868:Fbxo32 UTSW 15 58214590 missense probably damaging 1.00
R7951:Fbxo32 UTSW 15 58214590 missense probably damaging 1.00
Z1176:Fbxo32 UTSW 15 58205242 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGTCTAATAAGAGAGGCAC -3'
(R):5'- AAGTCTGTGTCTGCATGGAC -3'

Sequencing Primer
(F):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
(R):5'- CTGTGTCTGCATGGACTTTGG -3'
Posted On2014-10-30