Incidental Mutation 'R2316:Garnl3'
ID 245472
Institutional Source Beutler Lab
Gene Symbol Garnl3
Ensembl Gene ENSMUSG00000038860
Gene Name GTPase activating RANGAP domain-like 3
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.111) question?
Stock # R2316 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 32876236-33021666 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 32895164 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 635 (L635P)
Ref Sequence ENSEMBL: ENSMUSP00000122576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049618] [ENSMUST00000102810] [ENSMUST00000137381]
AlphaFold Q3V0G7
Predicted Effect probably damaging
Transcript: ENSMUST00000049618
AA Change: L594P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057582
Gene: ENSMUSG00000038860
AA Change: L594P

DomainStartEndE-ValueType
Pfam:Rap_GAP 202 383 3.4e-73 PFAM
Pfam:CNH 475 780 3.5e-67 PFAM
low complexity region 793 804 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102810
AA Change: L590P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099874
Gene: ENSMUSG00000038860
AA Change: L590P

DomainStartEndE-ValueType
Pfam:Rap_GAP 198 385 4.6e-67 PFAM
Pfam:CNH 471 776 1.8e-68 PFAM
low complexity region 789 800 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137381
AA Change: L635P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193214
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik A G 14: 60,333,519 (GRCm39) probably benign Het
Acaca T C 11: 84,154,906 (GRCm39) M987T probably benign Het
Acaca A G 11: 84,185,809 (GRCm39) T115A possibly damaging Het
Aknad1 A T 3: 108,688,472 (GRCm39) D600V probably damaging Het
Arfgef3 T A 10: 18,492,701 (GRCm39) T1237S probably benign Het
Brd4 A T 17: 32,431,884 (GRCm39) L660Q probably benign Het
Casp1 A G 9: 5,306,213 (GRCm39) D366G possibly damaging Het
Casp8ap2 C A 4: 32,643,781 (GRCm39) S951R probably benign Het
Chd9 A G 8: 91,777,756 (GRCm39) E2589G probably damaging Het
Dchs1 T C 7: 105,413,411 (GRCm39) T1135A possibly damaging Het
Dnhd1 T C 7: 105,323,628 (GRCm39) V633A probably damaging Het
Dock6 G T 9: 21,750,973 (GRCm39) H400Q probably damaging Het
Dzip1 A G 14: 119,138,952 (GRCm39) F426L probably benign Het
Elovl4 A G 9: 83,662,826 (GRCm39) S236P probably damaging Het
Emp1 T C 6: 135,357,123 (GRCm39) F67S probably damaging Het
Htr7 C A 19: 35,946,703 (GRCm39) probably null Het
Kcnd3 A C 3: 105,576,442 (GRCm39) S629R probably benign Het
Lrp2 T A 2: 69,322,191 (GRCm39) I1913F possibly damaging Het
Med19 T A 2: 84,516,587 (GRCm39) D208E probably benign Het
Mettl21c A T 1: 44,052,792 (GRCm39) V75E probably damaging Het
Nhsl3 T C 4: 129,117,540 (GRCm39) T375A probably damaging Het
Nsd1 A T 13: 55,381,779 (GRCm39) R64S probably damaging Het
Or10g3b A G 14: 52,587,395 (GRCm39) I36T probably benign Het
Or51v8 A T 7: 103,319,674 (GRCm39) I188N probably damaging Het
Or5p50 T A 7: 107,422,007 (GRCm39) Y223F probably benign Het
Peds1 T A 2: 167,496,635 (GRCm39) Q46L possibly damaging Het
Plat T A 8: 23,266,881 (GRCm39) M291K probably benign Het
Psmb4 T C 3: 94,792,322 (GRCm39) E200G probably benign Het
Reln T C 5: 22,359,954 (GRCm39) Y190C probably benign Het
Rp1 A G 1: 4,415,863 (GRCm39) S1750P probably damaging Het
Slc5a4a T A 10: 76,013,915 (GRCm39) probably null Het
Sobp A T 10: 43,034,034 (GRCm39) N97K possibly damaging Het
Stac3 T C 10: 127,339,229 (GRCm39) probably null Het
Stat5b G T 11: 100,687,318 (GRCm39) T436K probably damaging Het
Tas1r3 A T 4: 155,947,772 (GRCm39) M7K probably benign Het
Vps13b C T 15: 35,675,045 (GRCm39) Q1722* probably null Het
Zfp677 A T 17: 21,617,582 (GRCm39) Y213F probably benign Het
Other mutations in Garnl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Garnl3 APN 2 32,896,828 (GRCm39) missense probably damaging 1.00
IGL01601:Garnl3 APN 2 32,887,701 (GRCm39) nonsense probably null
IGL01981:Garnl3 APN 2 32,887,741 (GRCm39) missense probably damaging 0.98
IGL02209:Garnl3 APN 2 32,975,942 (GRCm39) missense probably damaging 0.99
IGL02434:Garnl3 APN 2 32,944,217 (GRCm39) missense probably damaging 1.00
IGL02512:Garnl3 APN 2 32,921,150 (GRCm39) missense probably damaging 1.00
IGL02947:Garnl3 APN 2 32,936,606 (GRCm39) missense probably damaging 1.00
PIT4403001:Garnl3 UTSW 2 32,880,770 (GRCm39) missense probably damaging 1.00
R0123:Garnl3 UTSW 2 32,896,816 (GRCm39) missense possibly damaging 0.92
R0134:Garnl3 UTSW 2 32,896,816 (GRCm39) missense possibly damaging 0.92
R0225:Garnl3 UTSW 2 32,896,816 (GRCm39) missense possibly damaging 0.92
R0551:Garnl3 UTSW 2 32,906,750 (GRCm39) missense probably damaging 1.00
R0691:Garnl3 UTSW 2 32,975,919 (GRCm39) missense probably damaging 1.00
R0693:Garnl3 UTSW 2 32,975,919 (GRCm39) missense probably damaging 1.00
R0737:Garnl3 UTSW 2 32,880,654 (GRCm39) missense probably damaging 0.98
R1350:Garnl3 UTSW 2 32,942,226 (GRCm39) missense probably damaging 1.00
R1691:Garnl3 UTSW 2 32,887,675 (GRCm39) nonsense probably null
R1791:Garnl3 UTSW 2 32,924,139 (GRCm39) missense probably benign 0.02
R1938:Garnl3 UTSW 2 32,895,212 (GRCm39) missense probably damaging 0.99
R2100:Garnl3 UTSW 2 32,936,657 (GRCm39) missense probably benign 0.35
R2353:Garnl3 UTSW 2 32,954,046 (GRCm39) missense probably damaging 1.00
R3161:Garnl3 UTSW 2 32,924,723 (GRCm39) missense probably damaging 1.00
R3839:Garnl3 UTSW 2 32,879,558 (GRCm39) missense probably benign 0.00
R3847:Garnl3 UTSW 2 32,882,240 (GRCm39) missense probably benign
R4871:Garnl3 UTSW 2 32,977,100 (GRCm39) start codon destroyed probably null 0.77
R5682:Garnl3 UTSW 2 32,944,185 (GRCm39) missense probably damaging 1.00
R5811:Garnl3 UTSW 2 32,896,911 (GRCm39) missense probably damaging 0.99
R6267:Garnl3 UTSW 2 32,994,892 (GRCm39) missense probably benign 0.20
R6502:Garnl3 UTSW 2 32,896,833 (GRCm39) missense possibly damaging 0.67
R6532:Garnl3 UTSW 2 32,921,131 (GRCm39) missense possibly damaging 0.87
R6639:Garnl3 UTSW 2 32,879,537 (GRCm39) missense possibly damaging 0.75
R6763:Garnl3 UTSW 2 32,944,208 (GRCm39) missense probably damaging 1.00
R6866:Garnl3 UTSW 2 32,892,785 (GRCm39) splice site probably null
R6913:Garnl3 UTSW 2 32,876,841 (GRCm39) missense possibly damaging 0.91
R7002:Garnl3 UTSW 2 32,944,205 (GRCm39) missense possibly damaging 0.65
R7168:Garnl3 UTSW 2 32,885,090 (GRCm39) missense probably damaging 1.00
R7341:Garnl3 UTSW 2 32,924,141 (GRCm39) missense probably damaging 1.00
R7746:Garnl3 UTSW 2 32,882,269 (GRCm39) missense probably damaging 1.00
R7919:Garnl3 UTSW 2 32,936,611 (GRCm39) missense probably benign 0.38
R8079:Garnl3 UTSW 2 32,908,511 (GRCm39) critical splice donor site probably null
R8087:Garnl3 UTSW 2 32,935,548 (GRCm39) missense probably benign 0.01
R8123:Garnl3 UTSW 2 32,994,950 (GRCm39) missense probably damaging 0.97
R8170:Garnl3 UTSW 2 32,905,235 (GRCm39) missense possibly damaging 0.88
R8347:Garnl3 UTSW 2 32,975,903 (GRCm39) missense probably damaging 1.00
R8418:Garnl3 UTSW 2 32,942,158 (GRCm39) missense possibly damaging 0.73
R8679:Garnl3 UTSW 2 32,916,106 (GRCm39) missense probably damaging 1.00
R8940:Garnl3 UTSW 2 32,895,241 (GRCm39) critical splice acceptor site probably null
R9081:Garnl3 UTSW 2 32,896,920 (GRCm39) missense possibly damaging 0.90
R9183:Garnl3 UTSW 2 32,895,080 (GRCm39) missense probably damaging 1.00
R9213:Garnl3 UTSW 2 32,895,080 (GRCm39) missense probably damaging 1.00
R9219:Garnl3 UTSW 2 32,975,898 (GRCm39) missense probably damaging 1.00
R9453:Garnl3 UTSW 2 32,893,881 (GRCm39) missense probably damaging 1.00
X0022:Garnl3 UTSW 2 32,912,680 (GRCm39) missense probably damaging 1.00
X0023:Garnl3 UTSW 2 32,916,161 (GRCm39) missense probably damaging 1.00
X0024:Garnl3 UTSW 2 32,895,191 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTCTGGGCAAGTTAGGGTAC -3'
(R):5'- CCCAGGATTCTTAGGAACCG -3'

Sequencing Primer
(F):5'- CTGGGACCTCAGAGGGGATAC -3'
(R):5'- GGAACCGTTCCCAAAGTCC -3'
Posted On 2014-10-30