Incidental Mutation 'R2316:Med19'
ID 245474
Institutional Source Beutler Lab
Gene Symbol Med19
Ensembl Gene ENSMUSG00000027080
Gene Name mediator complex subunit 19
Synonyms 3110040A13Rik, 2410018M14Rik, LCMR1
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2316 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 84508746-84518559 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 84516587 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 208 (D208E)
Ref Sequence ENSEMBL: ENSMUSP00000099705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035840] [ENSMUST00000102645]
AlphaFold Q8C1S0
Predicted Effect probably benign
Transcript: ENSMUST00000035840
SMART Domains Protein: ENSMUSP00000048198
Gene: ENSMUSG00000034075

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 45 67 N/A INTRINSIC
Pfam:zf-DHHC 99 224 1.6e-37 PFAM
low complexity region 312 318 N/A INTRINSIC
low complexity region 359 373 N/A INTRINSIC
low complexity region 422 432 N/A INTRINSIC
low complexity region 581 597 N/A INTRINSIC
low complexity region 679 695 N/A INTRINSIC
low complexity region 698 708 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102645
AA Change: D208E

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099705
Gene: ENSMUSG00000027080
AA Change: D208E

DomainStartEndE-ValueType
low complexity region 24 55 N/A INTRINSIC
Pfam:Med19 63 234 4e-87 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141595
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the Mediator complex, which binds to gene-specific regulatory factors and provides support for the basal RNA polymerase II transcription machinery. This gene has been implicated in the growth of several types of cancer, and inhibition of its expression inhibits the growth and spread of these cancers. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik A G 14: 60,333,519 (GRCm39) probably benign Het
Acaca T C 11: 84,154,906 (GRCm39) M987T probably benign Het
Acaca A G 11: 84,185,809 (GRCm39) T115A possibly damaging Het
Aknad1 A T 3: 108,688,472 (GRCm39) D600V probably damaging Het
Arfgef3 T A 10: 18,492,701 (GRCm39) T1237S probably benign Het
Brd4 A T 17: 32,431,884 (GRCm39) L660Q probably benign Het
Casp1 A G 9: 5,306,213 (GRCm39) D366G possibly damaging Het
Casp8ap2 C A 4: 32,643,781 (GRCm39) S951R probably benign Het
Chd9 A G 8: 91,777,756 (GRCm39) E2589G probably damaging Het
Dchs1 T C 7: 105,413,411 (GRCm39) T1135A possibly damaging Het
Dnhd1 T C 7: 105,323,628 (GRCm39) V633A probably damaging Het
Dock6 G T 9: 21,750,973 (GRCm39) H400Q probably damaging Het
Dzip1 A G 14: 119,138,952 (GRCm39) F426L probably benign Het
Elovl4 A G 9: 83,662,826 (GRCm39) S236P probably damaging Het
Emp1 T C 6: 135,357,123 (GRCm39) F67S probably damaging Het
Garnl3 A G 2: 32,895,164 (GRCm39) L635P probably damaging Het
Htr7 C A 19: 35,946,703 (GRCm39) probably null Het
Kcnd3 A C 3: 105,576,442 (GRCm39) S629R probably benign Het
Lrp2 T A 2: 69,322,191 (GRCm39) I1913F possibly damaging Het
Mettl21c A T 1: 44,052,792 (GRCm39) V75E probably damaging Het
Nhsl3 T C 4: 129,117,540 (GRCm39) T375A probably damaging Het
Nsd1 A T 13: 55,381,779 (GRCm39) R64S probably damaging Het
Or10g3b A G 14: 52,587,395 (GRCm39) I36T probably benign Het
Or51v8 A T 7: 103,319,674 (GRCm39) I188N probably damaging Het
Or5p50 T A 7: 107,422,007 (GRCm39) Y223F probably benign Het
Peds1 T A 2: 167,496,635 (GRCm39) Q46L possibly damaging Het
Plat T A 8: 23,266,881 (GRCm39) M291K probably benign Het
Psmb4 T C 3: 94,792,322 (GRCm39) E200G probably benign Het
Reln T C 5: 22,359,954 (GRCm39) Y190C probably benign Het
Rp1 A G 1: 4,415,863 (GRCm39) S1750P probably damaging Het
Slc5a4a T A 10: 76,013,915 (GRCm39) probably null Het
Sobp A T 10: 43,034,034 (GRCm39) N97K possibly damaging Het
Stac3 T C 10: 127,339,229 (GRCm39) probably null Het
Stat5b G T 11: 100,687,318 (GRCm39) T436K probably damaging Het
Tas1r3 A T 4: 155,947,772 (GRCm39) M7K probably benign Het
Vps13b C T 15: 35,675,045 (GRCm39) Q1722* probably null Het
Zfp677 A T 17: 21,617,582 (GRCm39) Y213F probably benign Het
Other mutations in Med19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02148:Med19 APN 2 84,515,603 (GRCm39) missense probably damaging 1.00
IGL02175:Med19 APN 2 84,509,007 (GRCm39) critical splice donor site probably null
IGL02378:Med19 APN 2 84,515,625 (GRCm39) missense probably damaging 1.00
R0965:Med19 UTSW 2 84,508,793 (GRCm39) missense probably damaging 0.96
R1935:Med19 UTSW 2 84,516,002 (GRCm39) missense possibly damaging 0.73
R7857:Med19 UTSW 2 84,515,969 (GRCm39) missense probably damaging 1.00
R9032:Med19 UTSW 2 84,515,660 (GRCm39) missense probably damaging 0.97
R9035:Med19 UTSW 2 84,516,532 (GRCm39) splice site probably benign
R9278:Med19 UTSW 2 84,508,975 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGTAGCCTTAAGACTTTATAGCAG -3'
(R):5'- CTGCCTAGAACAACCCAGTG -3'

Sequencing Primer
(F):5'- CATTACAGATGGTTGTGAGCCACC -3'
(R):5'- TGACTTCAGCTCCAGGGCTTAAG -3'
Posted On 2014-10-30