Incidental Mutation 'R2316:Tmem189'
ID245475
Institutional Source Beutler Lab
Gene Symbol Tmem189
Ensembl Gene ENSMUSG00000090213
Gene Nametransmembrane protein 189
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2316 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location167642608-167689822 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 167654715 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 46 (Q46L)
Ref Sequence ENSEMBL: ENSMUSP00000006587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006587] [ENSMUST00000125544]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006587
AA Change: Q46L

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000006587
Gene: ENSMUSG00000090213
AA Change: Q46L

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
Pfam:Kua-UEV1_localn 85 263 4.9e-85 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000125544
AA Change: Q46L

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118416
Gene: ENSMUSG00000089739
AA Change: Q46L

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
low complexity region 76 88 N/A INTRINSIC
UBCc 239 371 1.53e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148262
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Co-transcription of this gene and the neighboring downstream gene (ubiquitin-conjugating enzyme E2 variant 1) generates a rare read-through transcript, which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. The protein encoded by this individual gene lacks a UEV1 domain but includes three transmembrane regions. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik A G 14: 60,096,070 probably benign Het
Acaca T C 11: 84,264,080 M987T probably benign Het
Acaca A G 11: 84,294,983 T115A possibly damaging Het
Aknad1 A T 3: 108,781,156 D600V probably damaging Het
Arfgef3 T A 10: 18,616,953 T1237S probably benign Het
Brd4 A T 17: 32,212,910 L660Q probably benign Het
C77080 T C 4: 129,223,747 T375A probably damaging Het
Casp1 A G 9: 5,306,213 D366G possibly damaging Het
Casp8ap2 C A 4: 32,643,781 S951R probably benign Het
Chd9 A G 8: 91,051,128 E2589G probably damaging Het
Dchs1 T C 7: 105,764,204 T1135A possibly damaging Het
Dnhd1 T C 7: 105,674,421 V633A probably damaging Het
Dock6 G T 9: 21,839,677 H400Q probably damaging Het
Dzip1 A G 14: 118,901,540 F426L probably benign Het
Elovl4 A G 9: 83,780,773 S236P probably damaging Het
Emp1 T C 6: 135,380,125 F67S probably damaging Het
Garnl3 A G 2: 33,005,152 L635P probably damaging Het
Htr7 C A 19: 35,969,303 probably null Het
Kcnd3 A C 3: 105,669,126 S629R probably benign Het
Lrp2 T A 2: 69,491,847 I1913F possibly damaging Het
Med19 T A 2: 84,686,243 D208E probably benign Het
Mettl21c A T 1: 44,013,632 V75E probably damaging Het
Nsd1 A T 13: 55,233,966 R64S probably damaging Het
Olfr1513 A G 14: 52,349,938 I36T probably benign Het
Olfr469 T A 7: 107,822,800 Y223F probably benign Het
Olfr624 A T 7: 103,670,467 I188N probably damaging Het
Plat T A 8: 22,776,865 M291K probably benign Het
Psmb4 T C 3: 94,885,011 E200G probably benign Het
Reln T C 5: 22,154,956 Y190C probably benign Het
Rp1 A G 1: 4,345,640 S1750P probably damaging Het
Slc5a4a T A 10: 76,178,081 probably null Het
Sobp A T 10: 43,158,038 N97K possibly damaging Het
Stac3 T C 10: 127,503,360 probably null Het
Stat5b G T 11: 100,796,492 T436K probably damaging Het
Tas1r3 A T 4: 155,863,315 M7K probably benign Het
Vps13b C T 15: 35,674,899 Q1722* probably null Het
Zfp677 A T 17: 21,397,320 Y213F probably benign Het
Other mutations in Tmem189
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0117:Tmem189 UTSW 2 167644758 splice site probably benign
R0505:Tmem189 UTSW 2 167644987 splice site probably benign
R7097:Tmem189 UTSW 2 167661478 missense probably benign
Z1088:Tmem189 UTSW 2 167644864 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCACCATGCCACTCAACTG -3'
(R):5'- CAACATTTGCTCAGTGTCCTGC -3'

Sequencing Primer
(F):5'- TCAACTGAATGCTCCAAGATGAG -3'
(R):5'- GCTTCTGCAAAAGCCCTTC -3'
Posted On2014-10-30