Incidental Mutation 'R2316:Tas1r3'
ID245482
Institutional Source Beutler Lab
Gene Symbol Tas1r3
Ensembl Gene ENSMUSG00000029072
Gene Nametaste receptor, type 1, member 3
SynonymsT1r3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R2316 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location155859268-155863362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 155863315 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 7 (M7K)
Ref Sequence ENSEMBL: ENSMUSP00000030949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030948] [ENSMUST00000030949] [ENSMUST00000030950] [ENSMUST00000151961] [ENSMUST00000168552]
Predicted Effect probably benign
Transcript: ENSMUST00000030948
SMART Domains Protein: ENSMUSP00000030948
Gene: ENSMUSG00000029071

DomainStartEndE-ValueType
DAX 1 85 2.17e-52 SMART
Pfam:Dishevelled 144 215 1.1e-31 PFAM
low complexity region 217 233 N/A INTRINSIC
low complexity region 235 246 N/A INTRINSIC
PDZ 260 339 3.13e-16 SMART
low complexity region 380 397 N/A INTRINSIC
DEP 425 499 1.47e-26 SMART
Pfam:Dsh_C 503 685 4.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030949
AA Change: M7K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030949
Gene: ENSMUSG00000029072
AA Change: M7K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 72 469 2e-79 PFAM
Pfam:NCD3G 500 552 1.9e-16 PFAM
Pfam:7tm_3 576 821 9.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030950
SMART Domains Protein: ENSMUSP00000030950
Gene: ENSMUSG00000029073

DomainStartEndE-ValueType
Pfam:GLTP 27 179 1.4e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143457
Predicted Effect probably benign
Transcript: ENSMUST00000151961
SMART Domains Protein: ENSMUSP00000115935
Gene: ENSMUSG00000029073

DomainStartEndE-ValueType
Pfam:GLTP 25 181 1.9e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156997
Predicted Effect probably benign
Transcript: ENSMUST00000168552
SMART Domains Protein: ENSMUSP00000133137
Gene: ENSMUSG00000029071

DomainStartEndE-ValueType
DAX 1 85 2.17e-52 SMART
Pfam:Dishevelled 90 247 1.7e-60 PFAM
PDZ 260 339 3.13e-16 SMART
low complexity region 380 397 N/A INTRINSIC
DEP 425 499 1.47e-26 SMART
Pfam:Dsh_C 503 685 7.6e-59 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor involved in taste responses. The encoded protein can form a heterodimeric receptor with TAS1R1 to elicit the umami taste response, or it can bind with TAS1R2 to form a receptor for the sweet taste response. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutation of this locus affects taste perception. Complete inactivation results in diminished behavioral and nervous repsonses to both sweet and umami tastants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik A G 14: 60,096,070 probably benign Het
Acaca T C 11: 84,264,080 M987T probably benign Het
Acaca A G 11: 84,294,983 T115A possibly damaging Het
Aknad1 A T 3: 108,781,156 D600V probably damaging Het
Arfgef3 T A 10: 18,616,953 T1237S probably benign Het
Brd4 A T 17: 32,212,910 L660Q probably benign Het
C77080 T C 4: 129,223,747 T375A probably damaging Het
Casp1 A G 9: 5,306,213 D366G possibly damaging Het
Casp8ap2 C A 4: 32,643,781 S951R probably benign Het
Chd9 A G 8: 91,051,128 E2589G probably damaging Het
Dchs1 T C 7: 105,764,204 T1135A possibly damaging Het
Dnhd1 T C 7: 105,674,421 V633A probably damaging Het
Dock6 G T 9: 21,839,677 H400Q probably damaging Het
Dzip1 A G 14: 118,901,540 F426L probably benign Het
Elovl4 A G 9: 83,780,773 S236P probably damaging Het
Emp1 T C 6: 135,380,125 F67S probably damaging Het
Garnl3 A G 2: 33,005,152 L635P probably damaging Het
Htr7 C A 19: 35,969,303 probably null Het
Kcnd3 A C 3: 105,669,126 S629R probably benign Het
Lrp2 T A 2: 69,491,847 I1913F possibly damaging Het
Med19 T A 2: 84,686,243 D208E probably benign Het
Mettl21c A T 1: 44,013,632 V75E probably damaging Het
Nsd1 A T 13: 55,233,966 R64S probably damaging Het
Olfr1513 A G 14: 52,349,938 I36T probably benign Het
Olfr469 T A 7: 107,822,800 Y223F probably benign Het
Olfr624 A T 7: 103,670,467 I188N probably damaging Het
Plat T A 8: 22,776,865 M291K probably benign Het
Psmb4 T C 3: 94,885,011 E200G probably benign Het
Reln T C 5: 22,154,956 Y190C probably benign Het
Rp1 A G 1: 4,345,640 S1750P probably damaging Het
Slc5a4a T A 10: 76,178,081 probably null Het
Sobp A T 10: 43,158,038 N97K possibly damaging Het
Stac3 T C 10: 127,503,360 probably null Het
Stat5b G T 11: 100,796,492 T436K probably damaging Het
Tmem189 T A 2: 167,654,715 Q46L possibly damaging Het
Vps13b C T 15: 35,674,899 Q1722* probably null Het
Zfp677 A T 17: 21,397,320 Y213F probably benign Het
Other mutations in Tas1r3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Tas1r3 APN 4 155861327 missense probably benign 0.43
IGL01587:Tas1r3 APN 4 155861359 missense probably damaging 0.99
IGL02314:Tas1r3 APN 4 155860662 missense probably damaging 1.00
IGL02747:Tas1r3 APN 4 155860460 missense possibly damaging 0.92
IGL02999:Tas1r3 APN 4 155862359 missense probably damaging 0.97
IGL03026:Tas1r3 APN 4 155861843 unclassified probably benign
IGL03407:Tas1r3 APN 4 155861982 unclassified probably null
R0122:Tas1r3 UTSW 4 155860833 missense probably benign
R0827:Tas1r3 UTSW 4 155860869 missense probably benign 0.02
R1700:Tas1r3 UTSW 4 155861570 missense probably benign
R1803:Tas1r3 UTSW 4 155860470 missense probably damaging 0.99
R1804:Tas1r3 UTSW 4 155860470 missense probably damaging 0.99
R1883:Tas1r3 UTSW 4 155862153 missense probably damaging 1.00
R1998:Tas1r3 UTSW 4 155862920 missense probably damaging 1.00
R2061:Tas1r3 UTSW 4 155860470 missense probably damaging 0.99
R2104:Tas1r3 UTSW 4 155862131 missense probably benign 0.26
R2127:Tas1r3 UTSW 4 155860470 missense probably damaging 0.99
R2129:Tas1r3 UTSW 4 155860470 missense probably damaging 0.99
R2237:Tas1r3 UTSW 4 155862218 missense possibly damaging 0.58
R2847:Tas1r3 UTSW 4 155860202 missense probably benign 0.08
R3619:Tas1r3 UTSW 4 155860953 missense probably damaging 0.99
R3870:Tas1r3 UTSW 4 155861353 missense probably damaging 1.00
R4194:Tas1r3 UTSW 4 155862985 missense probably damaging 1.00
R4195:Tas1r3 UTSW 4 155862985 missense probably damaging 1.00
R4420:Tas1r3 UTSW 4 155862332 missense probably damaging 0.99
R5577:Tas1r3 UTSW 4 155862065 missense probably benign 0.36
R6734:Tas1r3 UTSW 4 155860800 missense probably damaging 1.00
R7006:Tas1r3 UTSW 4 155862904 missense possibly damaging 0.93
R7231:Tas1r3 UTSW 4 155862826 missense probably damaging 1.00
R7490:Tas1r3 UTSW 4 155862023 missense probably damaging 0.97
R7895:Tas1r3 UTSW 4 155862548 missense probably damaging 1.00
R7978:Tas1r3 UTSW 4 155862548 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTACCACGGAGCCAAAGC -3'
(R):5'- TGAATGTATCACCGGAGCTCC -3'

Sequencing Primer
(F):5'- GCTGCCAAGCTTCGGTTCAC -3'
(R):5'- TATCACCGGAGCTCCTTGGG -3'
Posted On2014-10-30