Mutagenetix > Incidental Mutation

Incidental Mutation 'R2316:Tas1r3'

245482

Institutional Source

Beutler Lab

Gene Symbol

Tas1r3

Ensembl Gene

ENSMUSG00000029072

Gene Name

taste receptor, type 1, member 3

Synonyms

T1r3

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.078) question?

Stock #

R2316 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

155859268-155863362 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 155863315 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 7 (M7K)

Ref Sequence

ENSEMBL: ENSMUSP00000030949 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030948] [ENSMUST00000030949] [ENSMUST00000030950] [ENSMUST00000151961] [ENSMUST00000168552]

AlphaFold

Q925D8

Predicted Effect

probably benign
Transcript: ENSMUST00000030948

SMART Domains

Protein: ENSMUSP00000030948
Gene: ENSMUSG00000029071

Domain	Start	End	E-Value	Type
DAX	1	85	2.17e-52	SMART
Pfam:Dishevelled	144	215	1.1e-31	PFAM
low complexity region	217	233	N/A	INTRINSIC
low complexity region	235	246	N/A	INTRINSIC
PDZ	260	339	3.13e-16	SMART
low complexity region	380	397	N/A	INTRINSIC
DEP	425	499	1.47e-26	SMART
Pfam:Dsh_C	503	685	4.2e-67	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000030949
AA Change: M7K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000030949
Gene: ENSMUSG00000029072
AA Change: M7K

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:ANF_receptor	72	469	2e-79	PFAM
Pfam:NCD3G	500	552	1.9e-16	PFAM
Pfam:7tm_3	576	821	9.6e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000030950

SMART Domains

Protein: ENSMUSP00000030950
Gene: ENSMUSG00000029073

Domain	Start	End	E-Value	Type
Pfam:GLTP	27	179	1.4e-46	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133184

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141539

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143457

Predicted Effect

probably benign
Transcript: ENSMUST00000151961

SMART Domains

Protein: ENSMUSP00000115935
Gene: ENSMUSG00000029073

Domain	Start	End	E-Value	Type
Pfam:GLTP	25	181	1.9e-49	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156266

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156997

Predicted Effect

probably benign
Transcript: ENSMUST00000168552

SMART Domains

Protein: ENSMUSP00000133137
Gene: ENSMUSG00000029071

Domain	Start	End	E-Value	Type
DAX	1	85	2.17e-52	SMART
Pfam:Dishevelled	90	247	1.7e-60	PFAM
PDZ	260	339	3.13e-16	SMART
low complexity region	380	397	N/A	INTRINSIC
DEP	425	499	1.47e-26	SMART
Pfam:Dsh_C	503	685	7.6e-59	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor involved in taste responses. The encoded protein can form a heterodimeric receptor with TAS1R1 to elicit the umami taste response, or it can bind with TAS1R2 to form a receptor for the sweet taste response. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutation of this locus affects taste perception. Complete inactivation results in diminished behavioral and nervous repsonses to both sweet and umami tastants. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563I02Rik	A	G	14: 60,096,070		probably benign	Het
Acaca	T	C	11: 84,264,080	M987T	probably benign	Het
Acaca	A	G	11: 84,294,983	T115A	possibly damaging	Het
Aknad1	A	T	3: 108,781,156	D600V	probably damaging	Het
Arfgef3	T	A	10: 18,616,953	T1237S	probably benign	Het
Brd4	A	T	17: 32,212,910	L660Q	probably benign	Het
C77080	T	C	4: 129,223,747	T375A	probably damaging	Het
Casp1	A	G	9: 5,306,213	D366G	possibly damaging	Het
Casp8ap2	C	A	4: 32,643,781	S951R	probably benign	Het
Chd9	A	G	8: 91,051,128	E2589G	probably damaging	Het
Dchs1	T	C	7: 105,764,204	T1135A	possibly damaging	Het
Dnhd1	T	C	7: 105,674,421	V633A	probably damaging	Het
Dock6	G	T	9: 21,839,677	H400Q	probably damaging	Het
Dzip1	A	G	14: 118,901,540	F426L	probably benign	Het
Elovl4	A	G	9: 83,780,773	S236P	probably damaging	Het
Emp1	T	C	6: 135,380,125	F67S	probably damaging	Het
Garnl3	A	G	2: 33,005,152	L635P	probably damaging	Het
Htr7	C	A	19: 35,969,303		probably null	Het
Kcnd3	A	C	3: 105,669,126	S629R	probably benign	Het
Lrp2	T	A	2: 69,491,847	I1913F	possibly damaging	Het
Med19	T	A	2: 84,686,243	D208E	probably benign	Het
Mettl21c	A	T	1: 44,013,632	V75E	probably damaging	Het
Nsd1	A	T	13: 55,233,966	R64S	probably damaging	Het
Olfr1513	A	G	14: 52,349,938	I36T	probably benign	Het
Olfr469	T	A	7: 107,822,800	Y223F	probably benign	Het
Olfr624	A	T	7: 103,670,467	I188N	probably damaging	Het
Plat	T	A	8: 22,776,865	M291K	probably benign	Het
Psmb4	T	C	3: 94,885,011	E200G	probably benign	Het
Reln	T	C	5: 22,154,956	Y190C	probably benign	Het
Rp1	A	G	1: 4,345,640	S1750P	probably damaging	Het
Slc5a4a	T	A	10: 76,178,081		probably null	Het
Sobp	A	T	10: 43,158,038	N97K	possibly damaging	Het
Stac3	T	C	10: 127,503,360		probably null	Het
Stat5b	G	T	11: 100,796,492	T436K	probably damaging	Het
Tmem189	T	A	2: 167,654,715	Q46L	possibly damaging	Het
Vps13b	C	T	15: 35,674,899	Q1722*	probably null	Het
Zfp677	A	T	17: 21,397,320	Y213F	probably benign	Het

Other mutations in Tas1r3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01356:Tas1r3	APN	4	155861327	missense	probably benign	0.43
IGL01587:Tas1r3	APN	4	155861359	missense	probably damaging	0.99
IGL02314:Tas1r3	APN	4	155860662	missense	probably damaging	1.00
IGL02747:Tas1r3	APN	4	155860460	missense	possibly damaging	0.92
IGL02999:Tas1r3	APN	4	155862359	missense	probably damaging	0.97
IGL03026:Tas1r3	APN	4	155861843	unclassified	probably benign
IGL03407:Tas1r3	APN	4	155861982	splice site	probably null
R0122:Tas1r3	UTSW	4	155860833	missense	probably benign
R0827:Tas1r3	UTSW	4	155860869	missense	probably benign	0.02
R1700:Tas1r3	UTSW	4	155861570	missense	probably benign
R1803:Tas1r3	UTSW	4	155860470	missense	probably damaging	0.99
R1804:Tas1r3	UTSW	4	155860470	missense	probably damaging	0.99
R1883:Tas1r3	UTSW	4	155862153	missense	probably damaging	1.00
R1998:Tas1r3	UTSW	4	155862920	missense	probably damaging	1.00
R2061:Tas1r3	UTSW	4	155860470	missense	probably damaging	0.99
R2104:Tas1r3	UTSW	4	155862131	missense	probably benign	0.26
R2127:Tas1r3	UTSW	4	155860470	missense	probably damaging	0.99
R2129:Tas1r3	UTSW	4	155860470	missense	probably damaging	0.99
R2237:Tas1r3	UTSW	4	155862218	missense	possibly damaging	0.58
R2847:Tas1r3	UTSW	4	155860202	missense	probably benign	0.08
R3619:Tas1r3	UTSW	4	155860953	missense	probably damaging	0.99
R3870:Tas1r3	UTSW	4	155861353	missense	probably damaging	1.00
R4194:Tas1r3	UTSW	4	155862985	missense	probably damaging	1.00
R4195:Tas1r3	UTSW	4	155862985	missense	probably damaging	1.00
R4420:Tas1r3	UTSW	4	155862332	missense	probably damaging	0.99
R5577:Tas1r3	UTSW	4	155862065	missense	probably benign	0.36
R6734:Tas1r3	UTSW	4	155860800	missense	probably damaging	1.00
R7006:Tas1r3	UTSW	4	155862904	missense	possibly damaging	0.93
R7231:Tas1r3	UTSW	4	155862826	missense	probably damaging	1.00
R7490:Tas1r3	UTSW	4	155862023	missense	probably damaging	0.97
R7895:Tas1r3	UTSW	4	155862548	missense	probably damaging	1.00
R8701:Tas1r3	UTSW	4	155861046	missense	probably benign	0.00
R8796:Tas1r3	UTSW	4	155861391	missense	probably benign	0.15
R8941:Tas1r3	UTSW	4	155863143	critical splice donor site	probably null
R9371:Tas1r3	UTSW	4	155860602	missense	possibly damaging	0.75
R9576:Tas1r3	UTSW	4	155862365	missense	probably benign
R9743:Tas1r3	UTSW	4	155860799	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGTACCACGGAGCCAAAGC -3'
(R):5'- TGAATGTATCACCGGAGCTCC -3'

Sequencing Primer
(F):5'- GCTGCCAAGCTTCGGTTCAC -3'
(R):5'- TATCACCGGAGCTCCTTGGG -3'

Posted On

2014-10-30