Incidental Mutation 'R2316:Tas1r3'
ID 245482
Institutional Source Beutler Lab
Gene Symbol Tas1r3
Ensembl Gene ENSMUSG00000029072
Gene Name taste receptor, type 1, member 3
Synonyms T1r3
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R2316 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 155943725-155947810 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 155947772 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 7 (M7K)
Ref Sequence ENSEMBL: ENSMUSP00000030949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030948] [ENSMUST00000030949] [ENSMUST00000030950] [ENSMUST00000168552] [ENSMUST00000151961]
AlphaFold Q925D8
Predicted Effect probably benign
Transcript: ENSMUST00000030948
SMART Domains Protein: ENSMUSP00000030948
Gene: ENSMUSG00000029071

DomainStartEndE-ValueType
DAX 1 85 2.17e-52 SMART
Pfam:Dishevelled 144 215 1.1e-31 PFAM
low complexity region 217 233 N/A INTRINSIC
low complexity region 235 246 N/A INTRINSIC
PDZ 260 339 3.13e-16 SMART
low complexity region 380 397 N/A INTRINSIC
DEP 425 499 1.47e-26 SMART
Pfam:Dsh_C 503 685 4.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030949
AA Change: M7K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030949
Gene: ENSMUSG00000029072
AA Change: M7K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 72 469 2e-79 PFAM
Pfam:NCD3G 500 552 1.9e-16 PFAM
Pfam:7tm_3 576 821 9.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030950
SMART Domains Protein: ENSMUSP00000030950
Gene: ENSMUSG00000029073

DomainStartEndE-ValueType
Pfam:GLTP 27 179 1.4e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156997
Predicted Effect probably benign
Transcript: ENSMUST00000168552
SMART Domains Protein: ENSMUSP00000133137
Gene: ENSMUSG00000029071

DomainStartEndE-ValueType
DAX 1 85 2.17e-52 SMART
Pfam:Dishevelled 90 247 1.7e-60 PFAM
PDZ 260 339 3.13e-16 SMART
low complexity region 380 397 N/A INTRINSIC
DEP 425 499 1.47e-26 SMART
Pfam:Dsh_C 503 685 7.6e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151961
SMART Domains Protein: ENSMUSP00000115935
Gene: ENSMUSG00000029073

DomainStartEndE-ValueType
Pfam:GLTP 25 181 1.9e-49 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor involved in taste responses. The encoded protein can form a heterodimeric receptor with TAS1R1 to elicit the umami taste response, or it can bind with TAS1R2 to form a receptor for the sweet taste response. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutation of this locus affects taste perception. Complete inactivation results in diminished behavioral and nervous repsonses to both sweet and umami tastants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik A G 14: 60,333,519 (GRCm39) probably benign Het
Acaca T C 11: 84,154,906 (GRCm39) M987T probably benign Het
Acaca A G 11: 84,185,809 (GRCm39) T115A possibly damaging Het
Aknad1 A T 3: 108,688,472 (GRCm39) D600V probably damaging Het
Arfgef3 T A 10: 18,492,701 (GRCm39) T1237S probably benign Het
Brd4 A T 17: 32,431,884 (GRCm39) L660Q probably benign Het
Casp1 A G 9: 5,306,213 (GRCm39) D366G possibly damaging Het
Casp8ap2 C A 4: 32,643,781 (GRCm39) S951R probably benign Het
Chd9 A G 8: 91,777,756 (GRCm39) E2589G probably damaging Het
Dchs1 T C 7: 105,413,411 (GRCm39) T1135A possibly damaging Het
Dnhd1 T C 7: 105,323,628 (GRCm39) V633A probably damaging Het
Dock6 G T 9: 21,750,973 (GRCm39) H400Q probably damaging Het
Dzip1 A G 14: 119,138,952 (GRCm39) F426L probably benign Het
Elovl4 A G 9: 83,662,826 (GRCm39) S236P probably damaging Het
Emp1 T C 6: 135,357,123 (GRCm39) F67S probably damaging Het
Garnl3 A G 2: 32,895,164 (GRCm39) L635P probably damaging Het
Htr7 C A 19: 35,946,703 (GRCm39) probably null Het
Kcnd3 A C 3: 105,576,442 (GRCm39) S629R probably benign Het
Lrp2 T A 2: 69,322,191 (GRCm39) I1913F possibly damaging Het
Med19 T A 2: 84,516,587 (GRCm39) D208E probably benign Het
Mettl21c A T 1: 44,052,792 (GRCm39) V75E probably damaging Het
Nhsl3 T C 4: 129,117,540 (GRCm39) T375A probably damaging Het
Nsd1 A T 13: 55,381,779 (GRCm39) R64S probably damaging Het
Or10g3b A G 14: 52,587,395 (GRCm39) I36T probably benign Het
Or51v8 A T 7: 103,319,674 (GRCm39) I188N probably damaging Het
Or5p50 T A 7: 107,422,007 (GRCm39) Y223F probably benign Het
Peds1 T A 2: 167,496,635 (GRCm39) Q46L possibly damaging Het
Plat T A 8: 23,266,881 (GRCm39) M291K probably benign Het
Psmb4 T C 3: 94,792,322 (GRCm39) E200G probably benign Het
Reln T C 5: 22,359,954 (GRCm39) Y190C probably benign Het
Rp1 A G 1: 4,415,863 (GRCm39) S1750P probably damaging Het
Slc5a4a T A 10: 76,013,915 (GRCm39) probably null Het
Sobp A T 10: 43,034,034 (GRCm39) N97K possibly damaging Het
Stac3 T C 10: 127,339,229 (GRCm39) probably null Het
Stat5b G T 11: 100,687,318 (GRCm39) T436K probably damaging Het
Vps13b C T 15: 35,675,045 (GRCm39) Q1722* probably null Het
Zfp677 A T 17: 21,617,582 (GRCm39) Y213F probably benign Het
Other mutations in Tas1r3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Tas1r3 APN 4 155,945,784 (GRCm39) missense probably benign 0.43
IGL01587:Tas1r3 APN 4 155,945,816 (GRCm39) missense probably damaging 0.99
IGL02314:Tas1r3 APN 4 155,945,119 (GRCm39) missense probably damaging 1.00
IGL02747:Tas1r3 APN 4 155,944,917 (GRCm39) missense possibly damaging 0.92
IGL02999:Tas1r3 APN 4 155,946,816 (GRCm39) missense probably damaging 0.97
IGL03026:Tas1r3 APN 4 155,946,300 (GRCm39) unclassified probably benign
IGL03407:Tas1r3 APN 4 155,946,439 (GRCm39) splice site probably null
R0122:Tas1r3 UTSW 4 155,945,290 (GRCm39) missense probably benign
R0827:Tas1r3 UTSW 4 155,945,326 (GRCm39) missense probably benign 0.02
R1700:Tas1r3 UTSW 4 155,946,027 (GRCm39) missense probably benign
R1803:Tas1r3 UTSW 4 155,944,927 (GRCm39) missense probably damaging 0.99
R1804:Tas1r3 UTSW 4 155,944,927 (GRCm39) missense probably damaging 0.99
R1883:Tas1r3 UTSW 4 155,946,610 (GRCm39) missense probably damaging 1.00
R1998:Tas1r3 UTSW 4 155,947,377 (GRCm39) missense probably damaging 1.00
R2061:Tas1r3 UTSW 4 155,944,927 (GRCm39) missense probably damaging 0.99
R2104:Tas1r3 UTSW 4 155,946,588 (GRCm39) missense probably benign 0.26
R2127:Tas1r3 UTSW 4 155,944,927 (GRCm39) missense probably damaging 0.99
R2129:Tas1r3 UTSW 4 155,944,927 (GRCm39) missense probably damaging 0.99
R2237:Tas1r3 UTSW 4 155,946,675 (GRCm39) missense possibly damaging 0.58
R2847:Tas1r3 UTSW 4 155,944,659 (GRCm39) missense probably benign 0.08
R3619:Tas1r3 UTSW 4 155,945,410 (GRCm39) missense probably damaging 0.99
R3870:Tas1r3 UTSW 4 155,945,810 (GRCm39) missense probably damaging 1.00
R4194:Tas1r3 UTSW 4 155,947,442 (GRCm39) missense probably damaging 1.00
R4195:Tas1r3 UTSW 4 155,947,442 (GRCm39) missense probably damaging 1.00
R4420:Tas1r3 UTSW 4 155,946,789 (GRCm39) missense probably damaging 0.99
R5577:Tas1r3 UTSW 4 155,946,522 (GRCm39) missense probably benign 0.36
R6734:Tas1r3 UTSW 4 155,945,257 (GRCm39) missense probably damaging 1.00
R7006:Tas1r3 UTSW 4 155,947,361 (GRCm39) missense possibly damaging 0.93
R7231:Tas1r3 UTSW 4 155,947,283 (GRCm39) missense probably damaging 1.00
R7490:Tas1r3 UTSW 4 155,946,480 (GRCm39) missense probably damaging 0.97
R7895:Tas1r3 UTSW 4 155,947,005 (GRCm39) missense probably damaging 1.00
R8701:Tas1r3 UTSW 4 155,945,503 (GRCm39) missense probably benign 0.00
R8796:Tas1r3 UTSW 4 155,945,848 (GRCm39) missense probably benign 0.15
R8941:Tas1r3 UTSW 4 155,947,600 (GRCm39) critical splice donor site probably null
R9371:Tas1r3 UTSW 4 155,945,059 (GRCm39) missense possibly damaging 0.75
R9576:Tas1r3 UTSW 4 155,946,822 (GRCm39) missense probably benign
R9743:Tas1r3 UTSW 4 155,945,256 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTACCACGGAGCCAAAGC -3'
(R):5'- TGAATGTATCACCGGAGCTCC -3'

Sequencing Primer
(F):5'- GCTGCCAAGCTTCGGTTCAC -3'
(R):5'- TATCACCGGAGCTCCTTGGG -3'
Posted On 2014-10-30