Incidental Mutation 'R2316:Emp1'
ID 245486
Institutional Source Beutler Lab
Gene Symbol Emp1
Ensembl Gene ENSMUSG00000030208
Gene Name epithelial membrane protein 1
Synonyms
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2316 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 135339548-135360171 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 135357123 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 67 (F67S)
Ref Sequence ENSEMBL: ENSMUSP00000145069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032330] [ENSMUST00000111907] [ENSMUST00000154270] [ENSMUST00000205156]
AlphaFold P47801
Predicted Effect probably damaging
Transcript: ENSMUST00000032330
AA Change: F67S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032330
Gene: ENSMUSG00000030208
AA Change: F67S

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 154 1.6e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111907
AA Change: F67S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107538
Gene: ENSMUSG00000030208
AA Change: F67S

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 154 1.6e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204299
Predicted Effect probably damaging
Transcript: ENSMUST00000205156
AA Change: F67S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145069
Gene: ENSMUSG00000030208
AA Change: F67S

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 154 1.6e-56 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice do not exhibit an overt mutant phenotype in any parameter tested. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik A G 14: 60,333,519 (GRCm39) probably benign Het
Acaca T C 11: 84,154,906 (GRCm39) M987T probably benign Het
Acaca A G 11: 84,185,809 (GRCm39) T115A possibly damaging Het
Aknad1 A T 3: 108,688,472 (GRCm39) D600V probably damaging Het
Arfgef3 T A 10: 18,492,701 (GRCm39) T1237S probably benign Het
Brd4 A T 17: 32,431,884 (GRCm39) L660Q probably benign Het
Casp1 A G 9: 5,306,213 (GRCm39) D366G possibly damaging Het
Casp8ap2 C A 4: 32,643,781 (GRCm39) S951R probably benign Het
Chd9 A G 8: 91,777,756 (GRCm39) E2589G probably damaging Het
Dchs1 T C 7: 105,413,411 (GRCm39) T1135A possibly damaging Het
Dnhd1 T C 7: 105,323,628 (GRCm39) V633A probably damaging Het
Dock6 G T 9: 21,750,973 (GRCm39) H400Q probably damaging Het
Dzip1 A G 14: 119,138,952 (GRCm39) F426L probably benign Het
Elovl4 A G 9: 83,662,826 (GRCm39) S236P probably damaging Het
Garnl3 A G 2: 32,895,164 (GRCm39) L635P probably damaging Het
Htr7 C A 19: 35,946,703 (GRCm39) probably null Het
Kcnd3 A C 3: 105,576,442 (GRCm39) S629R probably benign Het
Lrp2 T A 2: 69,322,191 (GRCm39) I1913F possibly damaging Het
Med19 T A 2: 84,516,587 (GRCm39) D208E probably benign Het
Mettl21c A T 1: 44,052,792 (GRCm39) V75E probably damaging Het
Nhsl3 T C 4: 129,117,540 (GRCm39) T375A probably damaging Het
Nsd1 A T 13: 55,381,779 (GRCm39) R64S probably damaging Het
Or10g3b A G 14: 52,587,395 (GRCm39) I36T probably benign Het
Or51v8 A T 7: 103,319,674 (GRCm39) I188N probably damaging Het
Or5p50 T A 7: 107,422,007 (GRCm39) Y223F probably benign Het
Peds1 T A 2: 167,496,635 (GRCm39) Q46L possibly damaging Het
Plat T A 8: 23,266,881 (GRCm39) M291K probably benign Het
Psmb4 T C 3: 94,792,322 (GRCm39) E200G probably benign Het
Reln T C 5: 22,359,954 (GRCm39) Y190C probably benign Het
Rp1 A G 1: 4,415,863 (GRCm39) S1750P probably damaging Het
Slc5a4a T A 10: 76,013,915 (GRCm39) probably null Het
Sobp A T 10: 43,034,034 (GRCm39) N97K possibly damaging Het
Stac3 T C 10: 127,339,229 (GRCm39) probably null Het
Stat5b G T 11: 100,687,318 (GRCm39) T436K probably damaging Het
Tas1r3 A T 4: 155,947,772 (GRCm39) M7K probably benign Het
Vps13b C T 15: 35,675,045 (GRCm39) Q1722* probably null Het
Zfp677 A T 17: 21,617,582 (GRCm39) Y213F probably benign Het
Other mutations in Emp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02064:Emp1 APN 6 135,354,210 (GRCm39) start codon destroyed probably null 1.00
IGL02573:Emp1 APN 6 135,356,945 (GRCm39) missense probably benign 0.01
R1171:Emp1 UTSW 6 135,358,077 (GRCm39) missense probably damaging 1.00
R1916:Emp1 UTSW 6 135,357,128 (GRCm39) missense probably damaging 1.00
R5103:Emp1 UTSW 6 135,358,073 (GRCm39) missense probably benign 0.01
R7287:Emp1 UTSW 6 135,357,167 (GRCm39) missense probably benign 0.29
R9231:Emp1 UTSW 6 135,354,276 (GRCm39) missense probably damaging 1.00
R9727:Emp1 UTSW 6 135,358,016 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGACATCCTCTTCTGAAAGCAG -3'
(R):5'- GGGGAAACTGATGCTCTCATG -3'

Sequencing Primer
(F):5'- TTACGCAAATGCATCTGTAGGGC -3'
(R):5'- GTAAAATAGACTCTGCTGCTCTGG -3'
Posted On 2014-10-30