Incidental Mutation 'R2316:Or51v8'
ID 245488
Institutional Source Beutler Lab
Gene Symbol Or51v8
Ensembl Gene ENSMUSG00000045780
Gene Name olfactory receptor family 51 subfamily V member 8
Synonyms Olfr624, MOR4-2P, GA_x6K02T2PBJ9-6394126-6393197
Accession Numbers
Essential gene? Probably non essential (E-score: 0.115) question?
Stock # R2316 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 103319310-103320236 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 103319674 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 188 (I188N)
Ref Sequence ENSEMBL: ENSMUSP00000049938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062144]
AlphaFold F8VQI7
Predicted Effect probably damaging
Transcript: ENSMUST00000062144
AA Change: I188N

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049938
Gene: ENSMUSG00000045780
AA Change: I188N

DomainStartEndE-ValueType
Pfam:7tm_4 27 306 3.3e-138 PFAM
Pfam:7tm_1 37 288 1.8e-19 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik A G 14: 60,333,519 (GRCm39) probably benign Het
Acaca T C 11: 84,154,906 (GRCm39) M987T probably benign Het
Acaca A G 11: 84,185,809 (GRCm39) T115A possibly damaging Het
Aknad1 A T 3: 108,688,472 (GRCm39) D600V probably damaging Het
Arfgef3 T A 10: 18,492,701 (GRCm39) T1237S probably benign Het
Brd4 A T 17: 32,431,884 (GRCm39) L660Q probably benign Het
Casp1 A G 9: 5,306,213 (GRCm39) D366G possibly damaging Het
Casp8ap2 C A 4: 32,643,781 (GRCm39) S951R probably benign Het
Chd9 A G 8: 91,777,756 (GRCm39) E2589G probably damaging Het
Dchs1 T C 7: 105,413,411 (GRCm39) T1135A possibly damaging Het
Dnhd1 T C 7: 105,323,628 (GRCm39) V633A probably damaging Het
Dock6 G T 9: 21,750,973 (GRCm39) H400Q probably damaging Het
Dzip1 A G 14: 119,138,952 (GRCm39) F426L probably benign Het
Elovl4 A G 9: 83,662,826 (GRCm39) S236P probably damaging Het
Emp1 T C 6: 135,357,123 (GRCm39) F67S probably damaging Het
Garnl3 A G 2: 32,895,164 (GRCm39) L635P probably damaging Het
Htr7 C A 19: 35,946,703 (GRCm39) probably null Het
Kcnd3 A C 3: 105,576,442 (GRCm39) S629R probably benign Het
Lrp2 T A 2: 69,322,191 (GRCm39) I1913F possibly damaging Het
Med19 T A 2: 84,516,587 (GRCm39) D208E probably benign Het
Mettl21c A T 1: 44,052,792 (GRCm39) V75E probably damaging Het
Nhsl3 T C 4: 129,117,540 (GRCm39) T375A probably damaging Het
Nsd1 A T 13: 55,381,779 (GRCm39) R64S probably damaging Het
Or10g3b A G 14: 52,587,395 (GRCm39) I36T probably benign Het
Or5p50 T A 7: 107,422,007 (GRCm39) Y223F probably benign Het
Peds1 T A 2: 167,496,635 (GRCm39) Q46L possibly damaging Het
Plat T A 8: 23,266,881 (GRCm39) M291K probably benign Het
Psmb4 T C 3: 94,792,322 (GRCm39) E200G probably benign Het
Reln T C 5: 22,359,954 (GRCm39) Y190C probably benign Het
Rp1 A G 1: 4,415,863 (GRCm39) S1750P probably damaging Het
Slc5a4a T A 10: 76,013,915 (GRCm39) probably null Het
Sobp A T 10: 43,034,034 (GRCm39) N97K possibly damaging Het
Stac3 T C 10: 127,339,229 (GRCm39) probably null Het
Stat5b G T 11: 100,687,318 (GRCm39) T436K probably damaging Het
Tas1r3 A T 4: 155,947,772 (GRCm39) M7K probably benign Het
Vps13b C T 15: 35,675,045 (GRCm39) Q1722* probably null Het
Zfp677 A T 17: 21,617,582 (GRCm39) Y213F probably benign Het
Other mutations in Or51v8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02419:Or51v8 APN 7 103,319,682 (GRCm39) nonsense probably null
IGL02536:Or51v8 APN 7 103,320,164 (GRCm39) missense possibly damaging 0.78
IGL02684:Or51v8 APN 7 103,319,591 (GRCm39) missense probably benign 0.06
FR4548:Or51v8 UTSW 7 103,320,174 (GRCm39) nonsense probably null
FR4548:Or51v8 UTSW 7 103,320,167 (GRCm39) small insertion probably benign
FR4976:Or51v8 UTSW 7 103,320,173 (GRCm39) small insertion probably benign
R0295:Or51v8 UTSW 7 103,319,518 (GRCm39) missense probably damaging 1.00
R0518:Or51v8 UTSW 7 103,319,696 (GRCm39) missense possibly damaging 0.56
R0521:Or51v8 UTSW 7 103,319,696 (GRCm39) missense possibly damaging 0.56
R1352:Or51v8 UTSW 7 103,319,518 (GRCm39) missense probably damaging 1.00
R1779:Or51v8 UTSW 7 103,319,845 (GRCm39) missense probably benign 0.15
R1878:Or51v8 UTSW 7 103,319,389 (GRCm39) missense probably damaging 1.00
R1965:Or51v8 UTSW 7 103,320,103 (GRCm39) missense probably damaging 1.00
R2162:Or51v8 UTSW 7 103,320,079 (GRCm39) missense possibly damaging 0.95
R3792:Or51v8 UTSW 7 103,319,353 (GRCm39) missense probably damaging 1.00
R3848:Or51v8 UTSW 7 103,319,908 (GRCm39) missense probably damaging 0.99
R4120:Or51v8 UTSW 7 103,320,221 (GRCm39) missense probably benign
R4183:Or51v8 UTSW 7 103,320,178 (GRCm39) missense possibly damaging 0.87
R4853:Or51v8 UTSW 7 103,320,010 (GRCm39) missense probably damaging 1.00
R6351:Or51v8 UTSW 7 103,320,163 (GRCm39) missense possibly damaging 0.50
R7717:Or51v8 UTSW 7 103,320,152 (GRCm39) missense probably benign
R9091:Or51v8 UTSW 7 103,320,124 (GRCm39) missense probably damaging 1.00
R9270:Or51v8 UTSW 7 103,320,124 (GRCm39) missense probably damaging 1.00
R9273:Or51v8 UTSW 7 103,319,633 (GRCm39) missense probably benign 0.03
R9378:Or51v8 UTSW 7 103,319,389 (GRCm39) missense probably damaging 1.00
X0026:Or51v8 UTSW 7 103,319,602 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CGGTGAACCATAGTCAGACC -3'
(R):5'- GCCATTTGCAACCCTCTACG -3'

Sequencing Primer
(F):5'- GTGAACCATAGTCAGACCAATAATG -3'
(R):5'- TATTCCTCCATCCTAACCAATGACAG -3'
Posted On 2014-10-30