Incidental Mutation 'R0279:Lmntd2'
ID24549
Institutional Source Beutler Lab
Gene Symbol Lmntd2
Ensembl Gene ENSMUSG00000025500
Gene Namelamin tail domain containing 2
Synonyms1600016N20Rik
MMRRC Submission 038501-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R0279 (G1)
Quality Score219
Status Validated
Chromosome7
Chromosomal Location141209992-141214080 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 141213623 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026573] [ENSMUST00000046890] [ENSMUST00000047093] [ENSMUST00000070458] [ENSMUST00000084446] [ENSMUST00000127613] [ENSMUST00000133763] [ENSMUST00000141804] [ENSMUST00000148975] [ENSMUST00000153081] [ENSMUST00000170841] [ENSMUST00000209500] [ENSMUST00000210993]
Predicted Effect probably benign
Transcript: ENSMUST00000026573
SMART Domains Protein: ENSMUSP00000026573
Gene: ENSMUSG00000025500

DomainStartEndE-ValueType
coiled coil region 114 170 N/A INTRINSIC
low complexity region 286 298 N/A INTRINSIC
Pfam:LTD 375 482 1.3e-13 PFAM
low complexity region 567 578 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000046890
SMART Domains Protein: ENSMUSP00000038444
Gene: ENSMUSG00000038618

DomainStartEndE-ValueType
RA 6 89 1.67e-19 SMART
low complexity region 181 215 N/A INTRINSIC
low complexity region 217 244 N/A INTRINSIC
coiled coil region 259 300 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047093
SMART Domains Protein: ENSMUSP00000048691
Gene: ENSMUSG00000038637

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
Pfam:LRR_4 138 177 9.1e-8 PFAM
LRRcap 212 230 4.44e-1 SMART
low complexity region 294 310 N/A INTRINSIC
low complexity region 390 404 N/A INTRINSIC
low complexity region 449 458 N/A INTRINSIC
low complexity region 474 496 N/A INTRINSIC
low complexity region 523 536 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070458
SMART Domains Protein: ENSMUSP00000063912
Gene: ENSMUSG00000038637

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
Pfam:LRR_7 116 132 4e-2 PFAM
Pfam:LRR_8 116 171 8.7e-8 PFAM
Pfam:LRR_4 117 158 7.2e-11 PFAM
Pfam:LRR_1 139 159 2.9e-2 PFAM
LRRcap 212 230 4.44e-1 SMART
low complexity region 294 310 N/A INTRINSIC
low complexity region 390 404 N/A INTRINSIC
low complexity region 449 458 N/A INTRINSIC
low complexity region 474 496 N/A INTRINSIC
low complexity region 523 536 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084446
SMART Domains Protein: ENSMUSP00000081486
Gene: ENSMUSG00000038637

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
Pfam:LRR_7 116 132 3.5e-2 PFAM
Pfam:LRR_8 116 171 6.9e-8 PFAM
Pfam:LRR_4 117 158 6.7e-11 PFAM
Pfam:LRR_6 136 160 5.9e-2 PFAM
Pfam:LRR_1 139 159 2.6e-2 PFAM
Pfam:LRR_6 157 182 4.1e-2 PFAM
Pfam:LRR_1 161 199 5.9e-2 PFAM
LRRcap 212 230 4.44e-1 SMART
low complexity region 294 310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127613
Predicted Effect probably benign
Transcript: ENSMUST00000133763
SMART Domains Protein: ENSMUSP00000118313
Gene: ENSMUSG00000038618

DomainStartEndE-ValueType
RA 6 89 1.67e-19 SMART
low complexity region 181 200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141804
SMART Domains Protein: ENSMUSP00000115948
Gene: ENSMUSG00000038618

DomainStartEndE-ValueType
RA 6 89 1.67e-19 SMART
low complexity region 181 215 N/A INTRINSIC
low complexity region 217 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148975
SMART Domains Protein: ENSMUSP00000118078
Gene: ENSMUSG00000038618

DomainStartEndE-ValueType
Blast:RA 6 35 5e-13 BLAST
PDB:2CS4|A 7 35 2e-11 PDB
low complexity region 36 47 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149548
Predicted Effect probably benign
Transcript: ENSMUST00000153081
SMART Domains Protein: ENSMUSP00000123128
Gene: ENSMUSG00000038618

DomainStartEndE-ValueType
RA 6 89 1.67e-19 SMART
low complexity region 181 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170841
SMART Domains Protein: ENSMUSP00000130905
Gene: ENSMUSG00000025500

DomainStartEndE-ValueType
coiled coil region 124 180 N/A INTRINSIC
low complexity region 296 308 N/A INTRINSIC
SCOP:d1ifra_ 385 487 1e-22 SMART
low complexity region 577 588 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209760
Predicted Effect probably benign
Transcript: ENSMUST00000210993
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.1%
  • 20x: 89.6%
Validation Efficiency 99% (82/83)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2610528J11Rik A T 4: 118,529,293 M1L probably benign Het
5730596B20Rik T A 6: 52,179,202 probably benign Het
Acrbp T C 6: 125,053,954 probably null Het
Acss3 A G 10: 107,084,871 I126T possibly damaging Het
Aff3 T C 1: 38,535,569 E110G probably damaging Het
Aldh1a3 T C 7: 66,409,252 I113V probably benign Het
Aplp2 T C 9: 31,157,790 E525G probably damaging Het
Atp2b4 A G 1: 133,729,702 probably benign Het
Atp8a1 C T 5: 67,813,092 probably null Het
Bhmt A G 13: 93,625,464 C104R probably damaging Het
Ccdc151 A G 9: 21,990,247 probably benign Het
Cct5 T G 15: 31,591,031 E508A probably damaging Het
Celsr1 T A 15: 85,902,864 E2761D probably benign Het
Clstn1 T C 4: 149,643,674 S600P probably damaging Het
Cnppd1 A G 1: 75,136,929 S232P probably damaging Het
Crybb3 T C 5: 113,079,753 probably null Het
Csmd1 A G 8: 16,223,235 I861T probably damaging Het
Cyp2d10 A C 15: 82,405,339 S191A possibly damaging Het
Ddx10 T C 9: 53,235,304 D206G probably damaging Het
Dnah1 G T 14: 31,302,375 H916N possibly damaging Het
Dnah9 A G 11: 65,911,789 probably null Het
Epb42 G A 2: 121,029,044 probably benign Het
Etnppl A G 3: 130,629,413 R248G probably damaging Het
Eya3 T C 4: 132,719,247 F369L probably damaging Het
Fam129a T C 1: 151,709,206 probably null Het
Fam170b T C 14: 32,834,068 probably benign Het
Fli1 A T 9: 32,461,427 V105D probably damaging Het
Fmo1 T C 1: 162,830,272 I433M possibly damaging Het
Fndc3b C A 3: 27,457,006 C785F probably benign Het
Foxe3 T C 4: 114,925,568 D149G probably damaging Het
Gk5 T C 9: 96,174,804 probably benign Het
Gm14226 A G 2: 155,025,452 D443G possibly damaging Het
Gm9796 C T 11: 95,697,995 noncoding transcript Het
Golga4 A T 9: 118,568,993 R52S probably benign Het
Hey2 C A 10: 30,834,010 C249F probably damaging Het
Ipo9 A T 1: 135,420,363 probably benign Het
Ireb2 C A 9: 54,886,593 T269K probably benign Het
Kansl3 A G 1: 36,351,969 V274A probably damaging Het
Kcnk2 C T 1: 189,209,972 A352T possibly damaging Het
Lamc2 T C 1: 153,130,696 E903G probably benign Het
Lepr A G 4: 101,750,344 K253R probably benign Het
Lrrc39 A T 3: 116,578,303 T240S probably benign Het
Lrrc43 A G 5: 123,497,022 probably null Het
Maf T C 8: 115,705,756 M370V possibly damaging Het
Mib2 G A 4: 155,661,216 S46L possibly damaging Het
Mms22l C T 4: 24,497,867 T63I probably damaging Het
Morc2a T A 11: 3,683,989 S700R probably benign Het
Mpz A G 1: 171,159,929 probably benign Het
Ncam2 T C 16: 81,623,337 probably benign Het
Nudt14 C T 12: 112,938,417 A123T probably damaging Het
Olfr1016 A T 2: 85,799,535 I245N possibly damaging Het
Olfr13 G A 6: 43,174,758 M257I probably benign Het
Olfr239 C T 17: 33,199,324 T92I probably benign Het
Otoa T C 7: 121,111,079 probably benign Het
Pik3cg G A 12: 32,204,791 T399I probably damaging Het
Pkn3 C T 2: 30,083,297 A377V probably benign Het
Ppan A G 9: 20,891,529 N327S probably benign Het
Prkca T C 11: 108,054,111 probably benign Het
Prrc2c A T 1: 162,715,464 V320E probably damaging Het
Ptprq A G 10: 107,608,417 V1442A probably damaging Het
Rapgef1 C T 2: 29,726,227 R834C probably damaging Het
Rbms1 G T 2: 60,842,410 N44K probably damaging Het
Rfwd3 A C 8: 111,282,733 F404V probably benign Het
Rimbp3 G T 16: 17,209,453 R247L probably benign Het
Serpinb1b T C 13: 33,093,713 S310P possibly damaging Het
Smtn C A 11: 3,530,235 V329L probably damaging Het
Snapc2 T C 8: 4,254,979 probably benign Het
Spam1 A T 6: 24,800,419 M386L probably benign Het
Syne2 A G 12: 76,095,613 E6208G probably damaging Het
Teddm1a T C 1: 153,892,623 Y278H probably damaging Het
Tnfaip6 A T 2: 52,055,916 N258I possibly damaging Het
Trpm4 C T 7: 45,322,048 R188Q probably damaging Het
Ttbk2 A T 2: 120,748,960 H491Q probably benign Het
Urgcp C T 11: 5,716,989 E450K probably benign Het
Vmn1r228 T C 17: 20,776,375 N294D probably benign Het
Wdfy3 A T 5: 101,868,092 C2606S probably damaging Het
Wdr33 T A 18: 31,888,324 H642Q unknown Het
Zbtb46 A G 2: 181,411,774 S382P possibly damaging Het
Zfp217 A G 2: 170,119,780 I209T probably benign Het
Zranb3 T A 1: 127,963,773 N822I probably benign Het
Other mutations in Lmntd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Lmntd2 APN 7 141214039 missense probably damaging 1.00
IGL02444:Lmntd2 APN 7 141211919 missense probably damaging 1.00
IGL02806:Lmntd2 APN 7 141212039 missense probably benign
R0117:Lmntd2 UTSW 7 141210123 missense possibly damaging 0.92
R1686:Lmntd2 UTSW 7 141211085 missense probably damaging 1.00
R1970:Lmntd2 UTSW 7 141212059 unclassified probably benign
R2324:Lmntd2 UTSW 7 141210788 missense possibly damaging 0.62
R3429:Lmntd2 UTSW 7 141213997 missense probably benign 0.05
R3928:Lmntd2 UTSW 7 141211204 missense probably damaging 0.97
R4883:Lmntd2 UTSW 7 141212618 missense probably damaging 1.00
R4985:Lmntd2 UTSW 7 141213277 missense probably benign 0.00
R5219:Lmntd2 UTSW 7 141211474 splice site probably null
R7172:Lmntd2 UTSW 7 141213641 missense unknown
R7475:Lmntd2 UTSW 7 141210689 critical splice donor site probably null
R7847:Lmntd2 UTSW 7 141210150 missense probably benign 0.07
R7930:Lmntd2 UTSW 7 141210150 missense probably benign 0.07
X0027:Lmntd2 UTSW 7 141211050 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GCCAGTGCAGAGTAAACCCTAACAG -3'
(R):5'- TGCTCCGTCAAGCAGCAGTAAG -3'

Sequencing Primer
(F):5'- CAGGGGTCTACATGCTAGGG -3'
(R):5'- GGGCCAGCCTGATCAAAC -3'
Posted On2013-04-16