Incidental Mutation 'R2316:Casp1'
ID245495
Institutional Source Beutler Lab
Gene Symbol Casp1
Ensembl Gene ENSMUSG00000025888
Gene Namecaspase 1
SynonymsICE, Il1bc, Caspase-1, interleukin 1 beta-converting enzyme
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2316 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location5298517-5307265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5306213 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 366 (D366G)
Ref Sequence ENSEMBL: ENSMUSP00000027015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027012] [ENSMUST00000027015] [ENSMUST00000160064] [ENSMUST00000162846]
Predicted Effect probably benign
Transcript: ENSMUST00000027012
SMART Domains Protein: ENSMUSP00000027012
Gene: ENSMUSG00000033538

DomainStartEndE-ValueType
CARD 1 92 7.63e-7 SMART
CASc 121 371 5.72e-134 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000027015
AA Change: D366G

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027015
Gene: ENSMUSG00000025888
AA Change: D366G

DomainStartEndE-ValueType
CARD 4 89 4.91e-19 SMART
CASc 151 400 1.82e-136 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152651
Predicted Effect probably benign
Transcript: ENSMUST00000160064
SMART Domains Protein: ENSMUSP00000124249
Gene: ENSMUSG00000033538

DomainStartEndE-ValueType
CARD 1 89 4.7e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160521
Predicted Effect probably benign
Transcript: ENSMUST00000162846
SMART Domains Protein: ENSMUSP00000124402
Gene: ENSMUSG00000033538

DomainStartEndE-ValueType
Blast:CARD 2 36 2e-17 BLAST
PDB:1IBC|A 18 94 6e-12 PDB
SCOP:g1ibc.1 45 94 6e-15 SMART
Blast:CASc 65 94 7e-13 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce 2 subunits, large and small, that dimerize to form the active enzyme. This gene was identified by its ability to proteolytically cleave and activate the inactive precursor of interleukin-1, a cytokine involved in the processes such as inflammation, septic shock, and wound healing. This gene has been shown to induce cell apoptosis and may function in various developmental stages. Studies of a similar gene in mouse suggest a role in the pathogenesis of Huntington disease. Alternative splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous targeted mutants fail to produce mature IL1A and IL1B and are resistant to LPS-induced endotoxin shock and to FAS antibody-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik A G 14: 60,096,070 probably benign Het
Acaca T C 11: 84,264,080 M987T probably benign Het
Acaca A G 11: 84,294,983 T115A possibly damaging Het
Aknad1 A T 3: 108,781,156 D600V probably damaging Het
Arfgef3 T A 10: 18,616,953 T1237S probably benign Het
Brd4 A T 17: 32,212,910 L660Q probably benign Het
C77080 T C 4: 129,223,747 T375A probably damaging Het
Casp8ap2 C A 4: 32,643,781 S951R probably benign Het
Chd9 A G 8: 91,051,128 E2589G probably damaging Het
Dchs1 T C 7: 105,764,204 T1135A possibly damaging Het
Dnhd1 T C 7: 105,674,421 V633A probably damaging Het
Dock6 G T 9: 21,839,677 H400Q probably damaging Het
Dzip1 A G 14: 118,901,540 F426L probably benign Het
Elovl4 A G 9: 83,780,773 S236P probably damaging Het
Emp1 T C 6: 135,380,125 F67S probably damaging Het
Garnl3 A G 2: 33,005,152 L635P probably damaging Het
Htr7 C A 19: 35,969,303 probably null Het
Kcnd3 A C 3: 105,669,126 S629R probably benign Het
Lrp2 T A 2: 69,491,847 I1913F possibly damaging Het
Med19 T A 2: 84,686,243 D208E probably benign Het
Mettl21c A T 1: 44,013,632 V75E probably damaging Het
Nsd1 A T 13: 55,233,966 R64S probably damaging Het
Olfr1513 A G 14: 52,349,938 I36T probably benign Het
Olfr469 T A 7: 107,822,800 Y223F probably benign Het
Olfr624 A T 7: 103,670,467 I188N probably damaging Het
Plat T A 8: 22,776,865 M291K probably benign Het
Psmb4 T C 3: 94,885,011 E200G probably benign Het
Reln T C 5: 22,154,956 Y190C probably benign Het
Rp1 A G 1: 4,345,640 S1750P probably damaging Het
Slc5a4a T A 10: 76,178,081 probably null Het
Sobp A T 10: 43,158,038 N97K possibly damaging Het
Stac3 T C 10: 127,503,360 probably null Het
Stat5b G T 11: 100,796,492 T436K probably damaging Het
Tas1r3 A T 4: 155,863,315 M7K probably benign Het
Tmem189 T A 2: 167,654,715 Q46L possibly damaging Het
Vps13b C T 15: 35,674,899 Q1722* probably null Het
Zfp677 A T 17: 21,397,320 Y213F probably benign Het
Other mutations in Casp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Casp1 APN 9 5299872 splice site probably benign
IGL00667:Casp1 APN 9 5303756 missense probably benign 0.40
IGL01998:Casp1 APN 9 5303043 missense probably damaging 1.00
IGL02248:Casp1 APN 9 5299452 missense probably benign 0.01
IGL02469:Casp1 APN 9 5303105 missense probably benign 0.19
P0027:Casp1 UTSW 9 5299851 missense probably benign 0.00
PIT4305001:Casp1 UTSW 9 5306135 missense probably benign 0.03
R0724:Casp1 UTSW 9 5303077 missense probably benign
R1169:Casp1 UTSW 9 5299454 missense possibly damaging 0.93
R1876:Casp1 UTSW 9 5303663 missense probably benign 0.01
R2877:Casp1 UTSW 9 5303110 missense probably damaging 1.00
R2885:Casp1 UTSW 9 5299851 missense probably benign 0.00
R4043:Casp1 UTSW 9 5302444 missense probably benign
R4367:Casp1 UTSW 9 5299333 missense probably benign 0.41
R4656:Casp1 UTSW 9 5304324 missense probably damaging 1.00
R4705:Casp1 UTSW 9 5306204 missense probably damaging 1.00
R4790:Casp1 UTSW 9 5303020 missense probably benign 0.01
R4858:Casp1 UTSW 9 5306742 missense probably damaging 1.00
R5607:Casp1 UTSW 9 5303143 missense probably damaging 1.00
R5784:Casp1 UTSW 9 5299337 missense probably damaging 0.98
R6578:Casp1 UTSW 9 5304280 missense probably benign 0.04
R7111:Casp1 UTSW 9 5299816 missense probably benign 0.01
R7215:Casp1 UTSW 9 5298523 utr 5 prime probably null
R7590:Casp1 UTSW 9 5306710 missense probably damaging 1.00
R8002:Casp1 UTSW 9 5303164 missense possibly damaging 0.94
T0722:Casp1 UTSW 9 5299851 missense probably benign 0.00
X0003:Casp1 UTSW 9 5299851 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACCTAGAGTGGAAAGGCTAGATC -3'
(R):5'- TGCTCCATATTCTACCAAGGTAAAG -3'

Sequencing Primer
(F):5'- ATCTGTATCAAGGGTTAGGTCTATCC -3'
(R):5'- CACCATGTATGGATTGTTGA -3'
Posted On2014-10-30