Incidental Mutation 'R2316:Dock6'
ID 245496
Institutional Source Beutler Lab
Gene Symbol Dock6
Ensembl Gene ENSMUSG00000032198
Gene Name dedicator of cytokinesis 6
Synonyms 4931431C02Rik, 2410095B20Rik, C330023D02Rik
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.482) question?
Stock # R2316 (G1)
Quality Score 196
Status Not validated
Chromosome 9
Chromosomal Location 21711476-21764006 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 21750973 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 400 (H400Q)
Ref Sequence ENSEMBL: ENSMUSP00000034728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034728] [ENSMUST00000058777] [ENSMUST00000217336]
AlphaFold Q8VDR9
Predicted Effect probably damaging
Transcript: ENSMUST00000034728
AA Change: H400Q

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034728
Gene: ENSMUSG00000032198
AA Change: H400Q

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
Pfam:DUF3398 63 155 4.7e-26 PFAM
low complexity region 419 429 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
Pfam:DOCK-C2 542 721 3.4e-46 PFAM
low complexity region 754 770 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 945 965 N/A INTRINSIC
low complexity region 1057 1072 N/A INTRINSIC
low complexity region 1123 1153 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1340 1356 N/A INTRINSIC
Pfam:DHR-2 1554 2080 6.6e-214 PFAM
low complexity region 2093 2107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058777
SMART Domains Protein: ENSMUSP00000058951
Gene: ENSMUSG00000047822

DomainStartEndE-ValueType
low complexity region 171 191 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213775
Predicted Effect possibly damaging
Transcript: ENSMUST00000217336
AA Change: H400Q

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217515
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis (DOCK) family of atypical guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with small GTPases and are components of intracellular signaling networks. The encoded protein is a group C DOCK protein and plays a role in actin cytoskeletal reorganization by activating the Rho GTPases Cdc42 and Rac1. Mutations in this gene are associated with Adams-Oliver syndrome 2. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik A G 14: 60,333,519 (GRCm39) probably benign Het
Acaca T C 11: 84,154,906 (GRCm39) M987T probably benign Het
Acaca A G 11: 84,185,809 (GRCm39) T115A possibly damaging Het
Aknad1 A T 3: 108,688,472 (GRCm39) D600V probably damaging Het
Arfgef3 T A 10: 18,492,701 (GRCm39) T1237S probably benign Het
Brd4 A T 17: 32,431,884 (GRCm39) L660Q probably benign Het
Casp1 A G 9: 5,306,213 (GRCm39) D366G possibly damaging Het
Casp8ap2 C A 4: 32,643,781 (GRCm39) S951R probably benign Het
Chd9 A G 8: 91,777,756 (GRCm39) E2589G probably damaging Het
Dchs1 T C 7: 105,413,411 (GRCm39) T1135A possibly damaging Het
Dnhd1 T C 7: 105,323,628 (GRCm39) V633A probably damaging Het
Dzip1 A G 14: 119,138,952 (GRCm39) F426L probably benign Het
Elovl4 A G 9: 83,662,826 (GRCm39) S236P probably damaging Het
Emp1 T C 6: 135,357,123 (GRCm39) F67S probably damaging Het
Garnl3 A G 2: 32,895,164 (GRCm39) L635P probably damaging Het
Htr7 C A 19: 35,946,703 (GRCm39) probably null Het
Kcnd3 A C 3: 105,576,442 (GRCm39) S629R probably benign Het
Lrp2 T A 2: 69,322,191 (GRCm39) I1913F possibly damaging Het
Med19 T A 2: 84,516,587 (GRCm39) D208E probably benign Het
Mettl21c A T 1: 44,052,792 (GRCm39) V75E probably damaging Het
Nhsl3 T C 4: 129,117,540 (GRCm39) T375A probably damaging Het
Nsd1 A T 13: 55,381,779 (GRCm39) R64S probably damaging Het
Or10g3b A G 14: 52,587,395 (GRCm39) I36T probably benign Het
Or51v8 A T 7: 103,319,674 (GRCm39) I188N probably damaging Het
Or5p50 T A 7: 107,422,007 (GRCm39) Y223F probably benign Het
Peds1 T A 2: 167,496,635 (GRCm39) Q46L possibly damaging Het
Plat T A 8: 23,266,881 (GRCm39) M291K probably benign Het
Psmb4 T C 3: 94,792,322 (GRCm39) E200G probably benign Het
Reln T C 5: 22,359,954 (GRCm39) Y190C probably benign Het
Rp1 A G 1: 4,415,863 (GRCm39) S1750P probably damaging Het
Slc5a4a T A 10: 76,013,915 (GRCm39) probably null Het
Sobp A T 10: 43,034,034 (GRCm39) N97K possibly damaging Het
Stac3 T C 10: 127,339,229 (GRCm39) probably null Het
Stat5b G T 11: 100,687,318 (GRCm39) T436K probably damaging Het
Tas1r3 A T 4: 155,947,772 (GRCm39) M7K probably benign Het
Vps13b C T 15: 35,675,045 (GRCm39) Q1722* probably null Het
Zfp677 A T 17: 21,617,582 (GRCm39) Y213F probably benign Het
Other mutations in Dock6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Dock6 APN 9 21,757,930 (GRCm39) missense possibly damaging 0.50
IGL01025:Dock6 APN 9 21,723,103 (GRCm39) missense possibly damaging 0.89
IGL01390:Dock6 APN 9 21,714,341 (GRCm39) missense probably damaging 1.00
IGL02025:Dock6 APN 9 21,720,885 (GRCm39) missense probably damaging 0.98
IGL02028:Dock6 APN 9 21,750,122 (GRCm39) missense probably damaging 1.00
IGL02311:Dock6 APN 9 21,755,624 (GRCm39) missense probably damaging 1.00
IGL02441:Dock6 APN 9 21,753,222 (GRCm39) missense possibly damaging 0.77
IGL02504:Dock6 APN 9 21,757,951 (GRCm39) missense probably benign 0.19
IGL02516:Dock6 APN 9 21,713,881 (GRCm39) missense probably damaging 1.00
IGL02836:Dock6 APN 9 21,713,160 (GRCm39) missense probably damaging 1.00
IGL02894:Dock6 APN 9 21,723,111 (GRCm39) missense probably damaging 1.00
backwater UTSW 9 21,735,712 (GRCm39) missense probably benign 0.29
bayfront UTSW 9 21,733,041 (GRCm39) missense probably benign 0.29
marshland UTSW 9 21,752,899 (GRCm39) missense probably benign 0.00
Shallows UTSW 9 21,731,918 (GRCm39) missense probably benign
IGL03048:Dock6 UTSW 9 21,720,866 (GRCm39) missense probably damaging 1.00
R0370:Dock6 UTSW 9 21,725,861 (GRCm39) missense probably benign 0.29
R0504:Dock6 UTSW 9 21,713,732 (GRCm39) missense probably damaging 1.00
R0633:Dock6 UTSW 9 21,755,713 (GRCm39) missense probably benign 0.00
R0634:Dock6 UTSW 9 21,752,823 (GRCm39) missense probably damaging 1.00
R0671:Dock6 UTSW 9 21,715,923 (GRCm39) splice site probably benign
R0839:Dock6 UTSW 9 21,729,188 (GRCm39) missense probably benign 0.01
R0948:Dock6 UTSW 9 21,712,829 (GRCm39) missense probably damaging 1.00
R1022:Dock6 UTSW 9 21,744,908 (GRCm39) missense probably damaging 1.00
R1024:Dock6 UTSW 9 21,744,908 (GRCm39) missense probably damaging 1.00
R1073:Dock6 UTSW 9 21,757,814 (GRCm39) missense probably benign
R1463:Dock6 UTSW 9 21,743,202 (GRCm39) missense probably damaging 1.00
R1481:Dock6 UTSW 9 21,731,918 (GRCm39) missense probably benign
R1494:Dock6 UTSW 9 21,726,038 (GRCm39) missense probably benign 0.34
R1547:Dock6 UTSW 9 21,725,884 (GRCm39) missense probably damaging 1.00
R1654:Dock6 UTSW 9 21,716,139 (GRCm39) missense probably damaging 0.98
R1782:Dock6 UTSW 9 21,723,142 (GRCm39) missense probably damaging 1.00
R1905:Dock6 UTSW 9 21,740,870 (GRCm39) missense probably benign 0.37
R1908:Dock6 UTSW 9 21,752,925 (GRCm39) missense probably damaging 1.00
R1916:Dock6 UTSW 9 21,724,387 (GRCm39) missense probably damaging 1.00
R2132:Dock6 UTSW 9 21,757,814 (GRCm39) missense probably benign
R2197:Dock6 UTSW 9 21,744,177 (GRCm39) missense probably damaging 1.00
R2341:Dock6 UTSW 9 21,750,782 (GRCm39) splice site probably benign
R2519:Dock6 UTSW 9 21,727,629 (GRCm39) missense possibly damaging 0.54
R2924:Dock6 UTSW 9 21,720,926 (GRCm39) missense probably damaging 1.00
R2939:Dock6 UTSW 9 21,750,496 (GRCm39) missense possibly damaging 0.88
R2940:Dock6 UTSW 9 21,750,496 (GRCm39) missense possibly damaging 0.88
R3078:Dock6 UTSW 9 21,757,050 (GRCm39) splice site probably benign
R3081:Dock6 UTSW 9 21,750,496 (GRCm39) missense possibly damaging 0.88
R3810:Dock6 UTSW 9 21,712,873 (GRCm39) missense probably damaging 1.00
R4246:Dock6 UTSW 9 21,750,786 (GRCm39) splice site probably null
R4604:Dock6 UTSW 9 21,713,836 (GRCm39) missense probably damaging 1.00
R4833:Dock6 UTSW 9 21,755,576 (GRCm39) missense probably damaging 1.00
R4849:Dock6 UTSW 9 21,723,068 (GRCm39) critical splice donor site probably null
R4896:Dock6 UTSW 9 21,735,733 (GRCm39) missense possibly damaging 0.48
R4926:Dock6 UTSW 9 21,757,087 (GRCm39) missense probably damaging 1.00
R5183:Dock6 UTSW 9 21,752,899 (GRCm39) missense probably benign 0.00
R5211:Dock6 UTSW 9 21,731,648 (GRCm39) missense probably benign 0.36
R5337:Dock6 UTSW 9 21,740,844 (GRCm39) missense possibly damaging 0.93
R5353:Dock6 UTSW 9 21,726,082 (GRCm39) missense probably benign 0.00
R5429:Dock6 UTSW 9 21,744,177 (GRCm39) missense probably damaging 0.99
R5463:Dock6 UTSW 9 21,721,254 (GRCm39) splice site probably null
R5476:Dock6 UTSW 9 21,720,885 (GRCm39) missense probably damaging 0.98
R5511:Dock6 UTSW 9 21,728,703 (GRCm39) missense possibly damaging 0.59
R5534:Dock6 UTSW 9 21,714,372 (GRCm39) nonsense probably null
R5718:Dock6 UTSW 9 21,735,789 (GRCm39) missense probably benign 0.11
R5823:Dock6 UTSW 9 21,716,124 (GRCm39) missense probably damaging 0.99
R5831:Dock6 UTSW 9 21,714,332 (GRCm39) missense probably damaging 1.00
R5887:Dock6 UTSW 9 21,731,690 (GRCm39) missense probably damaging 0.96
R5930:Dock6 UTSW 9 21,735,712 (GRCm39) missense probably benign 0.29
R6159:Dock6 UTSW 9 21,733,041 (GRCm39) missense probably benign 0.29
R6633:Dock6 UTSW 9 21,732,799 (GRCm39) missense probably damaging 1.00
R6633:Dock6 UTSW 9 21,731,627 (GRCm39) missense probably benign 0.17
R6665:Dock6 UTSW 9 21,751,208 (GRCm39) missense probably damaging 0.99
R6744:Dock6 UTSW 9 21,742,770 (GRCm39) missense probably damaging 1.00
R6903:Dock6 UTSW 9 21,720,860 (GRCm39) missense probably damaging 1.00
R6981:Dock6 UTSW 9 21,756,846 (GRCm39) missense probably damaging 0.99
R7024:Dock6 UTSW 9 21,731,666 (GRCm39) missense probably benign
R7030:Dock6 UTSW 9 21,724,375 (GRCm39) missense probably damaging 1.00
R7045:Dock6 UTSW 9 21,733,107 (GRCm39) missense probably damaging 1.00
R7139:Dock6 UTSW 9 21,712,572 (GRCm39) missense probably damaging 1.00
R7356:Dock6 UTSW 9 21,721,195 (GRCm39) missense probably damaging 1.00
R7400:Dock6 UTSW 9 21,713,103 (GRCm39) missense possibly damaging 0.62
R7847:Dock6 UTSW 9 21,712,503 (GRCm39) missense unknown
R7863:Dock6 UTSW 9 21,757,954 (GRCm39) missense possibly damaging 0.85
R7991:Dock6 UTSW 9 21,757,858 (GRCm39) missense probably damaging 1.00
R7992:Dock6 UTSW 9 21,744,135 (GRCm39) critical splice donor site probably null
R8012:Dock6 UTSW 9 21,757,807 (GRCm39) missense probably benign 0.16
R8184:Dock6 UTSW 9 21,741,596 (GRCm39) missense possibly damaging 0.54
R8213:Dock6 UTSW 9 21,742,740 (GRCm39) missense possibly damaging 0.77
R8560:Dock6 UTSW 9 21,714,132 (GRCm39) missense probably benign 0.00
R8828:Dock6 UTSW 9 21,757,797 (GRCm39) missense probably benign
R9090:Dock6 UTSW 9 21,752,796 (GRCm39) missense possibly damaging 0.75
R9221:Dock6 UTSW 9 21,721,153 (GRCm39) missense possibly damaging 0.77
R9271:Dock6 UTSW 9 21,752,796 (GRCm39) missense possibly damaging 0.75
R9301:Dock6 UTSW 9 21,729,111 (GRCm39) missense probably benign
R9308:Dock6 UTSW 9 21,728,744 (GRCm39) nonsense probably null
R9476:Dock6 UTSW 9 21,724,821 (GRCm39) missense probably damaging 1.00
R9526:Dock6 UTSW 9 21,713,802 (GRCm39) nonsense probably null
R9544:Dock6 UTSW 9 21,732,830 (GRCm39) nonsense probably null
R9716:Dock6 UTSW 9 21,742,418 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCGTTCTAGGAGACATCAGC -3'
(R):5'- CACAGCGAAGGTATGTGTGG -3'

Sequencing Primer
(F):5'- TTCTAGGAGACATCAGCAAGGTAGC -3'
(R):5'- TGTGGGTGAGCCGGACAG -3'
Posted On 2014-10-30