Incidental Mutation 'R2316:Elovl4'
ID245497
Institutional Source Beutler Lab
Gene Symbol Elovl4
Ensembl Gene ENSMUSG00000032262
Gene Nameelongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2316 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location83778692-83806277 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83780773 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 236 (S236P)
Ref Sequence ENSEMBL: ENSMUSP00000034796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034796] [ENSMUST00000183614]
Predicted Effect probably damaging
Transcript: ENSMUST00000034796
AA Change: S236P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034796
Gene: ENSMUSG00000032262
AA Change: S236P

DomainStartEndE-ValueType
Pfam:ELO 41 278 1e-69 PFAM
low complexity region 300 311 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183614
AA Change: S145P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139163
Gene: ENSMUSG00000032262
AA Change: S145P

DomainStartEndE-ValueType
Pfam:ELO 9 181 1.6e-50 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-bound protein which is a member of the ELO family, proteins which participate in the biosynthesis of fatty acids. Consistent with the expression of the encoded protein in photoreceptor cells of the retina, mutations and small deletions in this gene are associated with Stargardt-like macular dystrophy (STGD3) and autosomal dominant Stargardt-like macular dystrophy (ADMD), also referred to as autosomal dominant atrophic macular degeneration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die before or around birth. Mice heterozygous for a null allele breed poorly and display mild retinal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik A G 14: 60,096,070 probably benign Het
Acaca T C 11: 84,264,080 M987T probably benign Het
Acaca A G 11: 84,294,983 T115A possibly damaging Het
Aknad1 A T 3: 108,781,156 D600V probably damaging Het
Arfgef3 T A 10: 18,616,953 T1237S probably benign Het
Brd4 A T 17: 32,212,910 L660Q probably benign Het
C77080 T C 4: 129,223,747 T375A probably damaging Het
Casp1 A G 9: 5,306,213 D366G possibly damaging Het
Casp8ap2 C A 4: 32,643,781 S951R probably benign Het
Chd9 A G 8: 91,051,128 E2589G probably damaging Het
Dchs1 T C 7: 105,764,204 T1135A possibly damaging Het
Dnhd1 T C 7: 105,674,421 V633A probably damaging Het
Dock6 G T 9: 21,839,677 H400Q probably damaging Het
Dzip1 A G 14: 118,901,540 F426L probably benign Het
Emp1 T C 6: 135,380,125 F67S probably damaging Het
Garnl3 A G 2: 33,005,152 L635P probably damaging Het
Htr7 C A 19: 35,969,303 probably null Het
Kcnd3 A C 3: 105,669,126 S629R probably benign Het
Lrp2 T A 2: 69,491,847 I1913F possibly damaging Het
Med19 T A 2: 84,686,243 D208E probably benign Het
Mettl21c A T 1: 44,013,632 V75E probably damaging Het
Nsd1 A T 13: 55,233,966 R64S probably damaging Het
Olfr1513 A G 14: 52,349,938 I36T probably benign Het
Olfr469 T A 7: 107,822,800 Y223F probably benign Het
Olfr624 A T 7: 103,670,467 I188N probably damaging Het
Plat T A 8: 22,776,865 M291K probably benign Het
Psmb4 T C 3: 94,885,011 E200G probably benign Het
Reln T C 5: 22,154,956 Y190C probably benign Het
Rp1 A G 1: 4,345,640 S1750P probably damaging Het
Slc5a4a T A 10: 76,178,081 probably null Het
Sobp A T 10: 43,158,038 N97K possibly damaging Het
Stac3 T C 10: 127,503,360 probably null Het
Stat5b G T 11: 100,796,492 T436K probably damaging Het
Tas1r3 A T 4: 155,863,315 M7K probably benign Het
Tmem189 T A 2: 167,654,715 Q46L possibly damaging Het
Vps13b C T 15: 35,674,899 Q1722* probably null Het
Zfp677 A T 17: 21,397,320 Y213F probably benign Het
Other mutations in Elovl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
hershey UTSW 9 83806038 start codon destroyed probably null 0.31
R0278:Elovl4 UTSW 9 83783195 missense probably benign 0.00
R0563:Elovl4 UTSW 9 83785034 critical splice donor site probably null
R0739:Elovl4 UTSW 9 83785109 missense probably damaging 1.00
R0771:Elovl4 UTSW 9 83785115 missense possibly damaging 0.95
R1970:Elovl4 UTSW 9 83780719 missense probably damaging 1.00
R3777:Elovl4 UTSW 9 83785148 frame shift probably null
R3779:Elovl4 UTSW 9 83785148 frame shift probably null
R4823:Elovl4 UTSW 9 83780685 missense probably damaging 1.00
R4827:Elovl4 UTSW 9 83806038 start codon destroyed probably null 0.31
R5264:Elovl4 UTSW 9 83780764 missense probably benign 0.19
R5275:Elovl4 UTSW 9 83780661 missense possibly damaging 0.72
R5295:Elovl4 UTSW 9 83780661 missense possibly damaging 0.72
R5361:Elovl4 UTSW 9 83790101 missense possibly damaging 0.95
R5364:Elovl4 UTSW 9 83790023 missense probably benign 0.21
R5897:Elovl4 UTSW 9 83790104 missense possibly damaging 0.50
R6433:Elovl4 UTSW 9 83785178 missense possibly damaging 0.46
R6668:Elovl4 UTSW 9 83805986 missense probably benign 0.02
R6844:Elovl4 UTSW 9 83790111 missense probably benign 0.09
R6897:Elovl4 UTSW 9 83783225 missense probably benign 0.05
R6933:Elovl4 UTSW 9 83785100 missense probably damaging 1.00
R7534:Elovl4 UTSW 9 83790119 missense probably damaging 1.00
R7544:Elovl4 UTSW 9 83783218 missense probably damaging 1.00
R7843:Elovl4 UTSW 9 83788271 missense probably damaging 1.00
R7926:Elovl4 UTSW 9 83788271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATTCACGCCGTTCGATGAGATAC -3'
(R):5'- GCAACGGATCTGTGGCAATC -3'

Sequencing Primer
(F):5'- ATGAGATACCATTCGTGGCC -3'
(R):5'- CACTAGAATGCCTTTGCTGAGCAG -3'
Posted On2014-10-30