Incidental Mutation 'R2316:Elovl4'
ID 245497
Institutional Source Beutler Lab
Gene Symbol Elovl4
Ensembl Gene ENSMUSG00000032262
Gene Name ELOVL fatty acid elongase 4
Synonyms elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2316 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 83660745-83688330 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 83662826 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 236 (S236P)
Ref Sequence ENSEMBL: ENSMUSP00000034796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034796] [ENSMUST00000183614]
AlphaFold Q9EQC4
Predicted Effect probably damaging
Transcript: ENSMUST00000034796
AA Change: S236P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034796
Gene: ENSMUSG00000032262
AA Change: S236P

DomainStartEndE-ValueType
Pfam:ELO 41 278 1e-69 PFAM
low complexity region 300 311 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183614
AA Change: S145P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139163
Gene: ENSMUSG00000032262
AA Change: S145P

DomainStartEndE-ValueType
Pfam:ELO 9 181 1.6e-50 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-bound protein which is a member of the ELO family, proteins which participate in the biosynthesis of fatty acids. Consistent with the expression of the encoded protein in photoreceptor cells of the retina, mutations and small deletions in this gene are associated with Stargardt-like macular dystrophy (STGD3) and autosomal dominant Stargardt-like macular dystrophy (ADMD), also referred to as autosomal dominant atrophic macular degeneration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die before or around birth. Mice heterozygous for a null allele breed poorly and display mild retinal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik A G 14: 60,333,519 (GRCm39) probably benign Het
Acaca T C 11: 84,154,906 (GRCm39) M987T probably benign Het
Acaca A G 11: 84,185,809 (GRCm39) T115A possibly damaging Het
Aknad1 A T 3: 108,688,472 (GRCm39) D600V probably damaging Het
Arfgef3 T A 10: 18,492,701 (GRCm39) T1237S probably benign Het
Brd4 A T 17: 32,431,884 (GRCm39) L660Q probably benign Het
Casp1 A G 9: 5,306,213 (GRCm39) D366G possibly damaging Het
Casp8ap2 C A 4: 32,643,781 (GRCm39) S951R probably benign Het
Chd9 A G 8: 91,777,756 (GRCm39) E2589G probably damaging Het
Dchs1 T C 7: 105,413,411 (GRCm39) T1135A possibly damaging Het
Dnhd1 T C 7: 105,323,628 (GRCm39) V633A probably damaging Het
Dock6 G T 9: 21,750,973 (GRCm39) H400Q probably damaging Het
Dzip1 A G 14: 119,138,952 (GRCm39) F426L probably benign Het
Emp1 T C 6: 135,357,123 (GRCm39) F67S probably damaging Het
Garnl3 A G 2: 32,895,164 (GRCm39) L635P probably damaging Het
Htr7 C A 19: 35,946,703 (GRCm39) probably null Het
Kcnd3 A C 3: 105,576,442 (GRCm39) S629R probably benign Het
Lrp2 T A 2: 69,322,191 (GRCm39) I1913F possibly damaging Het
Med19 T A 2: 84,516,587 (GRCm39) D208E probably benign Het
Mettl21c A T 1: 44,052,792 (GRCm39) V75E probably damaging Het
Nhsl3 T C 4: 129,117,540 (GRCm39) T375A probably damaging Het
Nsd1 A T 13: 55,381,779 (GRCm39) R64S probably damaging Het
Or10g3b A G 14: 52,587,395 (GRCm39) I36T probably benign Het
Or51v8 A T 7: 103,319,674 (GRCm39) I188N probably damaging Het
Or5p50 T A 7: 107,422,007 (GRCm39) Y223F probably benign Het
Peds1 T A 2: 167,496,635 (GRCm39) Q46L possibly damaging Het
Plat T A 8: 23,266,881 (GRCm39) M291K probably benign Het
Psmb4 T C 3: 94,792,322 (GRCm39) E200G probably benign Het
Reln T C 5: 22,359,954 (GRCm39) Y190C probably benign Het
Rp1 A G 1: 4,415,863 (GRCm39) S1750P probably damaging Het
Slc5a4a T A 10: 76,013,915 (GRCm39) probably null Het
Sobp A T 10: 43,034,034 (GRCm39) N97K possibly damaging Het
Stac3 T C 10: 127,339,229 (GRCm39) probably null Het
Stat5b G T 11: 100,687,318 (GRCm39) T436K probably damaging Het
Tas1r3 A T 4: 155,947,772 (GRCm39) M7K probably benign Het
Vps13b C T 15: 35,675,045 (GRCm39) Q1722* probably null Het
Zfp677 A T 17: 21,617,582 (GRCm39) Y213F probably benign Het
Other mutations in Elovl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
hershey UTSW 9 83,688,091 (GRCm39) start codon destroyed probably null 0.31
R0278:Elovl4 UTSW 9 83,665,248 (GRCm39) missense probably benign 0.00
R0563:Elovl4 UTSW 9 83,667,087 (GRCm39) critical splice donor site probably null
R0739:Elovl4 UTSW 9 83,667,162 (GRCm39) missense probably damaging 1.00
R0771:Elovl4 UTSW 9 83,667,168 (GRCm39) missense possibly damaging 0.95
R1970:Elovl4 UTSW 9 83,662,772 (GRCm39) missense probably damaging 1.00
R3777:Elovl4 UTSW 9 83,667,201 (GRCm39) frame shift probably null
R3779:Elovl4 UTSW 9 83,667,201 (GRCm39) frame shift probably null
R4823:Elovl4 UTSW 9 83,662,738 (GRCm39) missense probably damaging 1.00
R4827:Elovl4 UTSW 9 83,688,091 (GRCm39) start codon destroyed probably null 0.31
R5264:Elovl4 UTSW 9 83,662,817 (GRCm39) missense probably benign 0.19
R5275:Elovl4 UTSW 9 83,662,714 (GRCm39) missense possibly damaging 0.72
R5295:Elovl4 UTSW 9 83,662,714 (GRCm39) missense possibly damaging 0.72
R5361:Elovl4 UTSW 9 83,672,154 (GRCm39) missense possibly damaging 0.95
R5364:Elovl4 UTSW 9 83,672,076 (GRCm39) missense probably benign 0.21
R5897:Elovl4 UTSW 9 83,672,157 (GRCm39) missense possibly damaging 0.50
R6433:Elovl4 UTSW 9 83,667,231 (GRCm39) missense possibly damaging 0.46
R6668:Elovl4 UTSW 9 83,688,039 (GRCm39) missense probably benign 0.02
R6844:Elovl4 UTSW 9 83,672,164 (GRCm39) missense probably benign 0.09
R6897:Elovl4 UTSW 9 83,665,278 (GRCm39) missense probably benign 0.05
R6933:Elovl4 UTSW 9 83,667,153 (GRCm39) missense probably damaging 1.00
R7534:Elovl4 UTSW 9 83,672,172 (GRCm39) missense probably damaging 1.00
R7544:Elovl4 UTSW 9 83,665,271 (GRCm39) missense probably damaging 1.00
R7843:Elovl4 UTSW 9 83,670,324 (GRCm39) missense probably damaging 1.00
R8303:Elovl4 UTSW 9 83,670,320 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TATTCACGCCGTTCGATGAGATAC -3'
(R):5'- GCAACGGATCTGTGGCAATC -3'

Sequencing Primer
(F):5'- ATGAGATACCATTCGTGGCC -3'
(R):5'- CACTAGAATGCCTTTGCTGAGCAG -3'
Posted On 2014-10-30