Incidental Mutation 'R2316:Slc5a4a'
ID 245500
Institutional Source Beutler Lab
Gene Symbol Slc5a4a
Ensembl Gene ENSMUSG00000020229
Gene Name solute carrier family 5, member 4a
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock # R2316 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 76147451-76189265 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 76178081 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020450] [ENSMUST00000020450] [ENSMUST00000020450]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000020450
SMART Domains Protein: ENSMUSP00000020450
Gene: ENSMUSG00000020229

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Pfam:SSF 58 492 4e-161 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 636 655 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000020450
SMART Domains Protein: ENSMUSP00000020450
Gene: ENSMUSG00000020229

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Pfam:SSF 58 492 4e-161 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 636 655 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000020450
SMART Domains Protein: ENSMUSP00000020450
Gene: ENSMUSG00000020229

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Pfam:SSF 58 492 4e-161 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 636 655 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik A G 14: 60,096,070 probably benign Het
Acaca T C 11: 84,264,080 M987T probably benign Het
Acaca A G 11: 84,294,983 T115A possibly damaging Het
Aknad1 A T 3: 108,781,156 D600V probably damaging Het
Arfgef3 T A 10: 18,616,953 T1237S probably benign Het
Brd4 A T 17: 32,212,910 L660Q probably benign Het
C77080 T C 4: 129,223,747 T375A probably damaging Het
Casp1 A G 9: 5,306,213 D366G possibly damaging Het
Casp8ap2 C A 4: 32,643,781 S951R probably benign Het
Chd9 A G 8: 91,051,128 E2589G probably damaging Het
Dchs1 T C 7: 105,764,204 T1135A possibly damaging Het
Dnhd1 T C 7: 105,674,421 V633A probably damaging Het
Dock6 G T 9: 21,839,677 H400Q probably damaging Het
Dzip1 A G 14: 118,901,540 F426L probably benign Het
Elovl4 A G 9: 83,780,773 S236P probably damaging Het
Emp1 T C 6: 135,380,125 F67S probably damaging Het
Garnl3 A G 2: 33,005,152 L635P probably damaging Het
Htr7 C A 19: 35,969,303 probably null Het
Kcnd3 A C 3: 105,669,126 S629R probably benign Het
Lrp2 T A 2: 69,491,847 I1913F possibly damaging Het
Med19 T A 2: 84,686,243 D208E probably benign Het
Mettl21c A T 1: 44,013,632 V75E probably damaging Het
Nsd1 A T 13: 55,233,966 R64S probably damaging Het
Olfr1513 A G 14: 52,349,938 I36T probably benign Het
Olfr469 T A 7: 107,822,800 Y223F probably benign Het
Olfr624 A T 7: 103,670,467 I188N probably damaging Het
Plat T A 8: 22,776,865 M291K probably benign Het
Psmb4 T C 3: 94,885,011 E200G probably benign Het
Reln T C 5: 22,154,956 Y190C probably benign Het
Rp1 A G 1: 4,345,640 S1750P probably damaging Het
Sobp A T 10: 43,158,038 N97K possibly damaging Het
Stac3 T C 10: 127,503,360 probably null Het
Stat5b G T 11: 100,796,492 T436K probably damaging Het
Tas1r3 A T 4: 155,863,315 M7K probably benign Het
Tmem189 T A 2: 167,654,715 Q46L possibly damaging Het
Vps13b C T 15: 35,674,899 Q1722* probably null Het
Zfp677 A T 17: 21,397,320 Y213F probably benign Het
Other mutations in Slc5a4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Slc5a4a APN 10 76163733 missense probably damaging 1.00
IGL01725:Slc5a4a APN 10 76181674 missense probably benign 0.00
IGL02629:Slc5a4a APN 10 76147579 missense unknown
IGL02976:Slc5a4a APN 10 76170693 missense possibly damaging 0.67
IGL03255:Slc5a4a APN 10 76150512 missense probably damaging 1.00
IGL03258:Slc5a4a APN 10 76150552 missense possibly damaging 0.81
R0054:Slc5a4a UTSW 10 76178197 missense probably null 0.00
R0244:Slc5a4a UTSW 10 76189152 missense possibly damaging 0.46
R0398:Slc5a4a UTSW 10 76182722 missense possibly damaging 0.46
R0799:Slc5a4a UTSW 10 76176534 missense probably benign 0.00
R1160:Slc5a4a UTSW 10 76178161 missense possibly damaging 0.52
R1471:Slc5a4a UTSW 10 76186528 missense probably damaging 0.99
R1720:Slc5a4a UTSW 10 76189269 splice site probably null
R1857:Slc5a4a UTSW 10 76166735 missense probably benign 0.27
R1858:Slc5a4a UTSW 10 76166735 missense probably benign 0.27
R1859:Slc5a4a UTSW 10 76166735 missense probably benign 0.27
R1942:Slc5a4a UTSW 10 76147588 missense unknown
R2016:Slc5a4a UTSW 10 76153580 missense probably benign 0.00
R3420:Slc5a4a UTSW 10 76176573 missense probably benign 0.00
R3421:Slc5a4a UTSW 10 76176573 missense probably benign 0.00
R3422:Slc5a4a UTSW 10 76176573 missense probably benign 0.00
R3845:Slc5a4a UTSW 10 76189149 missense probably damaging 0.99
R3874:Slc5a4a UTSW 10 76181655 missense probably benign 0.42
R4523:Slc5a4a UTSW 10 76148362 missense probably damaging 0.99
R4537:Slc5a4a UTSW 10 76178095 nonsense probably null
R4538:Slc5a4a UTSW 10 76178095 nonsense probably null
R4755:Slc5a4a UTSW 10 76186564 missense probably benign 0.00
R4868:Slc5a4a UTSW 10 76178231 missense probably damaging 0.98
R5135:Slc5a4a UTSW 10 76147594 missense unknown
R5254:Slc5a4a UTSW 10 76182738 nonsense probably null
R6083:Slc5a4a UTSW 10 76147597 missense unknown
R6331:Slc5a4a UTSW 10 76178200 missense probably damaging 0.98
R7591:Slc5a4a UTSW 10 76147667 critical splice donor site probably benign
R7671:Slc5a4a UTSW 10 76147550 missense unknown
R8785:Slc5a4a UTSW 10 76150404 critical splice acceptor site probably benign
R8929:Slc5a4a UTSW 10 76170783 missense probably benign 0.27
R8993:Slc5a4a UTSW 10 76186535 missense probably benign 0.15
R9018:Slc5a4a UTSW 10 76166712 missense possibly damaging 0.67
R9474:Slc5a4a UTSW 10 76150404 critical splice acceptor site probably benign
R9567:Slc5a4a UTSW 10 76186562 missense probably benign 0.08
R9648:Slc5a4a UTSW 10 76166774 missense probably damaging 1.00
Z1177:Slc5a4a UTSW 10 76166744 missense probably benign 0.01
Z1177:Slc5a4a UTSW 10 76182847 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTGCGATCACCAGGAGTTAC -3'
(R):5'- TGCAAACTCTAGTCTGCCTC -3'

Sequencing Primer
(F):5'- GAGTTACACAGGAAGCTCCACCTG -3'
(R):5'- CCTTCCTCAGAGGGGTTCTAG -3'
Posted On 2014-10-30